Incidental Mutation 'R6102:Apeh'
ID485317
Institutional Source Beutler Lab
Gene Symbol Apeh
Ensembl Gene ENSMUSG00000032590
Gene Nameacylpeptide hydrolase
SynonymsN-acylaminoacyl peptide hydrolase
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108085413-108094606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108086439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 559 (D559V)
Ref Sequence ENSEMBL: ENSMUSP00000141856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000162886] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081309
AA Change: D542V
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590
AA Change: D542V

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably damaging
Transcript: ENSMUST00000193254
AA Change: D559V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590
AA Change: D559V

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Apeh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Apeh APN 9 108086207 missense probably benign
IGL02232:Apeh APN 9 108091872 missense probably benign 0.02
IGL02563:Apeh APN 9 108093709 missense possibly damaging 0.85
IGL02713:Apeh APN 9 108085672 missense probably damaging 1.00
IGL02794:Apeh APN 9 108092010 missense possibly damaging 0.94
IGL03355:Apeh APN 9 108086445 missense probably benign 0.00
R6807_Apeh_606 UTSW 9 108092679 missense probably damaging 1.00
R0511:Apeh UTSW 9 108087055 missense probably benign
R1221:Apeh UTSW 9 108092609 missense probably benign
R1574:Apeh UTSW 9 108092726 splice site probably null
R1863:Apeh UTSW 9 108092103 missense possibly damaging 0.91
R2126:Apeh UTSW 9 108085667 missense probably damaging 1.00
R2353:Apeh UTSW 9 108086292 missense possibly damaging 0.84
R4930:Apeh UTSW 9 108087825 missense probably benign
R5156:Apeh UTSW 9 108094287 missense probably damaging 1.00
R5278:Apeh UTSW 9 108091258 missense probably benign 0.08
R5366:Apeh UTSW 9 108091806 missense probably benign 0.01
R5384:Apeh UTSW 9 108086463 missense probably damaging 1.00
R5940:Apeh UTSW 9 108091899 splice site probably null
R6300:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6368:Apeh UTSW 9 108087243 missense probably damaging 1.00
R6807:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6809:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6817:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6828:Apeh UTSW 9 108087038 missense probably damaging 1.00
R6866:Apeh UTSW 9 108092679 missense probably damaging 1.00
R7034:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7036:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7139:Apeh UTSW 9 108092146 missense probably damaging 1.00
R8024:Apeh UTSW 9 108092591 missense probably benign 0.20
R8289:Apeh UTSW 9 108086245 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAAGGGCCACACGTCTTGC -3'
(R):5'- CTGGAAAGGATGCTGTGGTC -3'

Sequencing Primer
(F):5'- GCATCAAAGTGTTCCTCCTGGAG -3'
(R):5'- TCGCCTTGACAGCCTGTGATG -3'
Posted On2017-08-16