Incidental Mutation 'R6102:Mtmr3'
ID485322
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Namemyotubularin related protein 3
SynonymsFYVE-DSP1, 1700092A20Rik, ZFYVE10
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4480868-4594863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4487673 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 927 (N927S)
Ref Sequence ENSEMBL: ENSMUSP00000137687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
Predicted Effect probably damaging
Transcript: ENSMUST00000040448
AA Change: N927S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: N927S

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109943
AA Change: N927S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: N927S

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123506
AA Change: N926S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: N926S

DomainStartEndE-ValueType
Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128256
AA Change: N926S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: N926S

DomainStartEndE-ValueType
Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130716
AA Change: N927S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: N927S

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155566
Meta Mutation Damage Score 0.1385 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4527861 missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4497404 missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4487938 missense probably benign
IGL02839:Mtmr3 APN 11 4487994 missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4507632 missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4487385 missense probably damaging 1.00
R0322:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4487536 missense probably damaging 0.99
R0655:Mtmr3 UTSW 11 4488610 missense probably damaging 1.00
R0866:Mtmr3 UTSW 11 4488474 missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4492859 missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4487923 missense probably benign
R1698:Mtmr3 UTSW 11 4492825 missense possibly damaging 0.95
R1707:Mtmr3 UTSW 11 4504095 missense probably damaging 1.00
R2191:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4491138 missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4491057 missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4487947 missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4497375 missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4491067 missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4527855 missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4507634 missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4488435 missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4487764 missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4498046 missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4487679 missense possibly damaging 0.47
R5847:Mtmr3 UTSW 11 4482925 missense probably damaging 1.00
R5933:Mtmr3 UTSW 11 4498951 missense probably benign
R6105:Mtmr3 UTSW 11 4485432 missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4497381 nonsense probably null
R6443:Mtmr3 UTSW 11 4487358 missense probably damaging 0.99
R6881:Mtmr3 UTSW 11 4489725 missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4489692 missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4498896 missense possibly damaging 0.94
T0975:Mtmr3 UTSW 11 4488441 missense probably benign
Z1176:Mtmr3 UTSW 11 4485913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCGAGTACAAGTGAGCAGAG -3'
(R):5'- AAAGTCAGAAAGTGGGCCCC -3'

Sequencing Primer
(F):5'- TACAAGTGAGCAGAGCTACAGC -3'
(R):5'- CCCAGCAAGCAGTGGTAGATTC -3'
Posted On2017-08-16