Incidental Mutation 'R6102:Strada'
List |< first << previous [record 54 of 68] next >> last >|
ID485329
Institutional Source Beutler Lab
Gene Symbol Strada
Ensembl Gene ENSMUSG00000069631
Gene NameSTE20-related kinase adaptor alpha
Synonyms2610019A05Rik, 6030402H20Rik
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106163330-106202168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106168436 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000007444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007444] [ENSMUST00000103072] [ENSMUST00000152008]
Predicted Effect probably benign
Transcript: ENSMUST00000007444
AA Change: V209A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631
AA Change: V209A

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103072
AA Change: V172A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099361
Gene: ENSMUSG00000069631
AA Change: V172A

DomainStartEndE-ValueType
Pfam:Pkinase 32 342 2.2e-35 PFAM
Pfam:Pkinase_Tyr 33 266 2.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122989
Predicted Effect probably benign
Transcript: ENSMUST00000152008
SMART Domains Protein: ENSMUSP00000115555
Gene: ENSMUSG00000069631

DomainStartEndE-ValueType
Pfam:Pkinase 32 159 7.4e-16 PFAM
Pfam:Pkinase_Tyr 33 159 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Strada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Strada APN 11 106171150 splice site probably benign
IGL00870:Strada APN 11 106171257 missense probably damaging 1.00
IGL01564:Strada APN 11 106173292 missense probably damaging 1.00
IGL02508:Strada APN 11 106168356 missense probably benign 0.03
IGL02816:Strada APN 11 106164425 unclassified probably benign
IGL03008:Strada APN 11 106170957 missense probably damaging 1.00
IGL03107:Strada APN 11 106164037 unclassified probably benign
R0587:Strada UTSW 11 106170964 missense probably damaging 1.00
R1614:Strada UTSW 11 106168319 missense probably damaging 1.00
R1764:Strada UTSW 11 106164184 missense probably damaging 0.96
R1852:Strada UTSW 11 106171221 missense possibly damaging 0.65
R3772:Strada UTSW 11 106164822 missense probably damaging 0.99
R4329:Strada UTSW 11 106187173 utr 5 prime probably benign
R4538:Strada UTSW 11 106167825 missense probably damaging 1.00
R5532:Strada UTSW 11 106171017 missense probably damaging 1.00
R6135:Strada UTSW 11 106173314 missense probably damaging 0.99
R6337:Strada UTSW 11 106173317 missense possibly damaging 0.80
R6773:Strada UTSW 11 106164907 missense probably damaging 0.99
R7155:Strada UTSW 11 106171039 missense probably damaging 1.00
R7509:Strada UTSW 11 106187094 missense unknown
R7552:Strada UTSW 11 106187004 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCAGTATTTCTGAGGCAAAC -3'
(R):5'- GCATATGTATGAGATGCAGTTACATAC -3'

Sequencing Primer
(F):5'- AGCACACTCCAGCGTTTC -3'
(R):5'- GCAGTTACATACATGTGATATGCCC -3'
Posted On2017-08-16