Incidental Mutation 'R6102:Frs3'
ID485342
Institutional Source Beutler Lab
Gene Symbol Frs3
Ensembl Gene ENSMUSG00000023266
Gene Namefibroblast growth factor receptor substrate 3
Synonyms4930417B13Rik, SNT2, Frs2beta
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47689030-47704286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47702671 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 173 (H173Y)
Ref Sequence ENSEMBL: ENSMUSP00000108921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113296] [ENSMUST00000156118]
Predicted Effect probably damaging
Transcript: ENSMUST00000113296
AA Change: H173Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266
AA Change: H173Y

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144979
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Frs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:Frs3 UTSW 17 47703822 missense probably benign
R0575:Frs3 UTSW 17 47703723 missense possibly damaging 0.89
R0638:Frs3 UTSW 17 47701656 missense probably benign 0.00
R1519:Frs3 UTSW 17 47702978 missense probably benign
R1668:Frs3 UTSW 17 47703222 missense possibly damaging 0.94
R2151:Frs3 UTSW 17 47703062 missense probably benign
R2517:Frs3 UTSW 17 47703072 missense probably benign 0.10
R3548:Frs3 UTSW 17 47703636 missense probably damaging 1.00
R3789:Frs3 UTSW 17 47699696 critical splice donor site probably null
R3890:Frs3 UTSW 17 47703435 missense probably damaging 0.99
R4981:Frs3 UTSW 17 47689262 splice site probably null
R4996:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5479:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5944:Frs3 UTSW 17 47692308 intron probably benign
R5990:Frs3 UTSW 17 47701677 missense possibly damaging 0.81
R6151:Frs3 UTSW 17 47689088 start gained probably benign
R7219:Frs3 UTSW 17 47702695 missense probably damaging 1.00
R7359:Frs3 UTSW 17 47699525 missense probably damaging 0.98
R7404:Frs3 UTSW 17 47702726 critical splice donor site probably null
R7962:Frs3 UTSW 17 47699538 missense possibly damaging 0.95
R8021:Frs3 UTSW 17 47703114 missense probably damaging 1.00
R8337:Frs3 UTSW 17 47703852 missense probably damaging 1.00
R8407:Frs3 UTSW 17 47698627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAGGATTGCAGGGCAC -3'
(R):5'- AAAGAGCCAGAGTTTCTCCTG -3'

Sequencing Primer
(F):5'- GGCACCTCAAATATGTGTGC -3'
(R):5'- AGAGTTTCTCCTGCCGCC -3'
Posted On2017-08-16