Incidental Mutation 'R6102:Dsc2'
ID485343
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission 044252-MU
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20047108 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 196 (Y196F)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
AA Change: Y196F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Y196F

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075214
AA Change: Y196F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Y196F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATAGTGACTGAAGTTAATAACCGC -3'
(R):5'- TCTGAAAACTGAATGCAACAGG -3'

Sequencing Primer
(F):5'- CCTTTGTAAGTGGAACAATCCCTGG -3'
(R):5'- ATTTTAGTAACTGGCAGTGAGATTG -3'
Posted On2017-08-16