Incidental Mutation 'R6103:Avpr1b'
ID485349
Institutional Source Beutler Lab
Gene Symbol Avpr1b
Ensembl Gene ENSMUSG00000026432
Gene Namearginine vasopressin receptor 1B
SynonymsVPR3, V1bR, V3/V1b, V3/V1b pituitary vasopressin receptor, AVPR3, V1BR
MMRRC Submission 044253-MU
Accession Numbers

Genbank: NM_011924; MGI: 1347010

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131599239-131612000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131609417 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 90 (P90S)
Ref Sequence ENSEMBL: ENSMUSP00000140527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027690] [ENSMUST00000190410]
Predicted Effect probably damaging
Transcript: ENSMUST00000027690
AA Change: T313I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027690
Gene: ENSMUSG00000026432
AA Change: T313I

DomainStartEndE-ValueType
Pfam:7tm_4 41 223 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 342 4.4e-7 PFAM
Pfam:7tm_1 51 335 1.6e-50 PFAM
Pfam:7TM_GPCR_Srv 106 352 8.2e-7 PFAM
DUF1856 359 411 1.6e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190410
AA Change: P90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140527
Gene: ENSMUSG00000026432
AA Change: P90S

DomainStartEndE-ValueType
Pfam:7tm_1 51 121 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele display dysregulation of the hypothalamic-pituitary-adrenal axis activity under stress and resting conditions. Homozygous null mice for other alleles display decreased aggression or an increased propensity for seizures. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(4) Targeted, other(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Avpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Avpr1b APN 1 131600147 missense probably damaging 1.00
IGL02516:Avpr1b APN 1 131600629 missense probably damaging 0.98
IGL02708:Avpr1b APN 1 131600651 missense probably damaging 1.00
IGL03122:Avpr1b APN 1 131600519 missense probably damaging 1.00
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0654:Avpr1b UTSW 1 131599742 start codon destroyed probably null 0.98
R0690:Avpr1b UTSW 1 131600281 missense probably damaging 0.99
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1704:Avpr1b UTSW 1 131609504 missense possibly damaging 0.80
R1732:Avpr1b UTSW 1 131600254 missense probably damaging 1.00
R1754:Avpr1b UTSW 1 131600101 missense probably damaging 1.00
R7246:Avpr1b UTSW 1 131600270 missense probably damaging 1.00
R7283:Avpr1b UTSW 1 131609731 missense probably benign 0.26
R8253:Avpr1b UTSW 1 131609416 missense probably benign 0.41
R8750:Avpr1b UTSW 1 131599936 missense probably damaging 0.99
Z1176:Avpr1b UTSW 1 131609573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGATTCAGCCTCTGTCC -3'
(R):5'- GTAGATGGACCACAGGTGTG -3'

Sequencing Primer
(F):5'- AGTTTGCACGACTAATGGGCC -3'
(R):5'- CACAGGTGTGGGTCAGCAG -3'
Posted On2017-08-16