Incidental Mutation 'R6103:Ankrd50'
ID485358
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38454429 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 340 (E340G)
Ref Sequence ENSEMBL: ENSMUSP00000091858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094300] [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect probably damaging
Transcript: ENSMUST00000094300
AA Change: E340G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091858
Gene: ENSMUSG00000044864
AA Change: E340G

DomainStartEndE-ValueType
ANK 18 47 1.16e-5 SMART
ANK 51 80 3.41e-3 SMART
ANK 84 113 2.9e-6 SMART
ANK 117 147 3.31e-1 SMART
low complexity region 216 243 N/A INTRINSIC
low complexity region 262 282 N/A INTRINSIC
low complexity region 301 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120875
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156038
AA Change: E1263G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: E1263G

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Meta Mutation Damage Score 0.2915 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4651001:Ankrd50 UTSW 3 38455810 nonsense probably null
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1076:Ankrd50 UTSW 3 38454922 missense probably damaging 0.97
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R3948:Ankrd50 UTSW 3 38482841 missense possibly damaging 0.75
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4577:Ankrd50 UTSW 3 38455941 missense probably damaging 0.98
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R5534:Ankrd50 UTSW 3 38456082 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
R7749:Ankrd50 UTSW 3 38482721 missense probably damaging 1.00
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Z1177:Ankrd50 UTSW 3 38455792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACACCTGGTTGCTCTGCAG -3'
(R):5'- TCCACAACCCAGTCCTTAGG -3'

Sequencing Primer
(F):5'- AATTGGGGTTCGTCATTATCCC -3'
(R):5'- TCCTTAGGACACAGCCATAATTCTC -3'
Posted On2017-08-16