Incidental Mutation 'R6103:Fgb'
ID485361
Institutional Source Beutler Lab
Gene Symbol Fgb
Ensembl Gene ENSMUSG00000033831
Gene Namefibrinogen beta chain
Synonyms2510049G14Rik
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83040141-83049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83043863 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 281 (D281G)
Ref Sequence ENSEMBL: ENSMUSP00000039472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048246]
Predicted Effect probably benign
Transcript: ENSMUST00000048246
AA Change: D281G

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039472
Gene: ENSMUSG00000033831
AA Change: D281G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Fib_alpha 80 225 1.28e-64 SMART
FBG 226 477 1.6e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded preproprotein is proteolytically processed by thrombin to release an N-terminal fibrinopeptide during the conversion of fibrinogen to insoluble fibrin polymer. The encoded protein interacts with the amyloid beta peptide to form fibrin clots of abnormal structure, and may play an important role in Alzheimer's disease. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Fgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Fgb APN 3 83043291 missense possibly damaging 0.95
IGL02129:Fgb APN 3 83043418 missense probably benign 0.05
IGL02148:Fgb APN 3 83043287 missense probably damaging 0.99
IGL02286:Fgb APN 3 83043326 missense probably benign
IGL02601:Fgb APN 3 83045060 missense probably benign 0.06
IGL02721:Fgb APN 3 83043367 missense possibly damaging 0.89
R1217:Fgb UTSW 3 83043257 missense probably damaging 0.99
R1424:Fgb UTSW 3 83046763 missense probably damaging 0.99
R1913:Fgb UTSW 3 83044980 missense probably benign 0.03
R1990:Fgb UTSW 3 83044253 nonsense probably null
R2063:Fgb UTSW 3 83049689 missense probably benign 0.09
R2065:Fgb UTSW 3 83049689 missense probably benign 0.09
R2066:Fgb UTSW 3 83049689 missense probably benign 0.09
R2067:Fgb UTSW 3 83049689 missense probably benign 0.09
R2251:Fgb UTSW 3 83043284 missense probably damaging 1.00
R4682:Fgb UTSW 3 83043265 missense probably benign 0.00
R5045:Fgb UTSW 3 83043373 missense probably damaging 1.00
R5573:Fgb UTSW 3 83049677 splice site probably null
R5766:Fgb UTSW 3 83046176 missense probably damaging 1.00
R6315:Fgb UTSW 3 83045055 missense probably benign 0.00
R6469:Fgb UTSW 3 83046142 nonsense probably null
R6664:Fgb UTSW 3 83046759 missense probably damaging 1.00
R6725:Fgb UTSW 3 83043791 missense probably damaging 1.00
R6727:Fgb UTSW 3 83046787 missense possibly damaging 0.62
R6830:Fgb UTSW 3 83045025 missense probably benign 0.07
R7016:Fgb UTSW 3 83046064 missense probably benign 0.01
R7132:Fgb UTSW 3 83046746 nonsense probably null
R7371:Fgb UTSW 3 83046052 missense probably damaging 0.99
R7430:Fgb UTSW 3 83046707 missense probably benign 0.26
R7681:Fgb UTSW 3 83049832 start gained probably benign
R7811:Fgb UTSW 3 83049697 missense probably benign
Z1177:Fgb UTSW 3 83045056 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAAGAGAATCCCCATCCTTGATG -3'
(R):5'- GTCATGCAGCACTTGAGATTTCC -3'

Sequencing Primer
(F):5'- GAGAATCCCCATCCTTGATGTTTTTG -3'
(R):5'- GCAGCACTTGAGATTTCCAAATAC -3'
Posted On2017-08-16