Incidental Mutation 'R6103:Cyp4x1'
ID 485364
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Name cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms Cyp4a28-ps
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 114963518-114991276 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114968864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 380 (L380P)
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
AlphaFold Q6A152
Predicted Effect probably damaging
Transcript: ENSMUST00000051400
AA Change: L406P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155
AA Change: L406P

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106545
AA Change: L380P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155
AA Change: L380P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Meta Mutation Damage Score 0.8763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,768,445 (GRCm39) S926P possibly damaging Het
Acacb T A 5: 114,383,942 (GRCm39) M2157K probably damaging Het
Aco2 T C 15: 81,797,452 (GRCm39) V636A probably benign Het
Adgrf3 T C 5: 30,401,265 (GRCm39) Y51C probably damaging Het
Adprhl1 T C 8: 13,272,055 (GRCm39) T1568A possibly damaging Het
Ank1 T A 8: 23,603,999 (GRCm39) S937T probably damaging Het
Ankrd50 T C 3: 38,508,578 (GRCm39) E340G probably damaging Het
Avpr1b C T 1: 131,537,155 (GRCm39) P90S probably damaging Het
Cacna2d3 T C 14: 29,118,446 (GRCm39) H159R probably damaging Het
Carmil3 A T 14: 55,742,884 (GRCm39) T1185S probably benign Het
Casp2 A T 6: 42,256,814 (GRCm39) R357S probably damaging Het
Ccdc34 A G 2: 109,848,352 (GRCm39) D47G probably benign Het
Cd109 A G 9: 78,605,596 (GRCm39) probably null Het
Cd209d T C 8: 3,928,304 (GRCm39) Y27C probably damaging Het
Cep350 T A 1: 155,800,322 (GRCm39) D1176V probably benign Het
Cpd A T 11: 76,690,625 (GRCm39) S844T probably benign Het
Dscam A G 16: 96,626,781 (GRCm39) V376A probably benign Het
Enam T A 5: 88,650,187 (GRCm39) N565K probably damaging Het
Fam110c G A 12: 31,124,794 (GRCm39) W252* probably null Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Fgb T C 3: 82,951,170 (GRCm39) D281G probably benign Het
Frem2 T A 3: 53,457,209 (GRCm39) T2048S probably benign Het
Fut8 A T 12: 77,378,721 (GRCm39) probably benign Het
Glmp T C 3: 88,235,338 (GRCm39) S238P probably benign Het
Gm35315 T A 5: 110,226,137 (GRCm39) Y434F probably damaging Het
Gnpnat1 A G 14: 45,620,856 (GRCm39) F71S probably damaging Het
Gpnmb A G 6: 49,019,820 (GRCm39) R64G possibly damaging Het
Grxcr1 T C 5: 68,323,547 (GRCm39) F275S possibly damaging Het
Ift140 T A 17: 25,312,100 (GRCm39) C1314S probably damaging Het
Kif9 T C 9: 110,318,917 (GRCm39) I127T possibly damaging Het
Mmd2 A G 5: 142,553,618 (GRCm39) probably null Het
Ms4a3 A T 19: 11,616,582 (GRCm39) V20D possibly damaging Het
Mtres1 A T 10: 43,408,916 (GRCm39) Y76N probably benign Het
Myh7b A G 2: 155,460,663 (GRCm39) E272G probably damaging Het
Naaladl1 G A 19: 6,158,743 (GRCm39) G292S probably damaging Het
Notch2 T A 3: 98,043,059 (GRCm39) Y1475N possibly damaging Het
Obp2a G A 2: 25,590,163 (GRCm39) E21K probably damaging Het
Or5ar1 A G 2: 85,671,776 (GRCm39) Y120H probably damaging Het
Osbpl10 T A 9: 114,890,940 (GRCm39) Y109* probably null Het
Plcd1 A T 9: 118,901,109 (GRCm39) W749R probably benign Het
Ptpro A G 6: 137,377,704 (GRCm39) E718G possibly damaging Het
Rbm4 C T 19: 4,837,947 (GRCm39) R295H probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Setdb2 T C 14: 59,646,981 (GRCm39) probably null Het
Slc25a18 C A 6: 120,766,399 (GRCm39) L131I probably damaging Het
Slc4a10 A G 2: 62,064,809 (GRCm39) H221R probably damaging Het
Tbc1d32 A T 10: 56,026,979 (GRCm39) W757R probably damaging Het
Tmem183a C A 1: 134,275,884 (GRCm39) V331L probably benign Het
Try10 C A 6: 41,333,484 (GRCm39) H76Q probably damaging Het
Ttn T A 2: 76,748,599 (GRCm39) H4150L probably benign Het
Vmn2r52 G A 7: 9,905,327 (GRCm39) P171S probably benign Het
Vmn2r88 A G 14: 51,652,826 (GRCm39) T450A probably benign Het
Yipf7 A T 5: 69,698,405 (GRCm39) V34D probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zg16 A G 7: 126,649,748 (GRCm39) V71A probably benign Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 114,979,145 (GRCm39) missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 114,970,060 (GRCm39) missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 114,978,946 (GRCm39) missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 114,965,982 (GRCm39) missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 114,970,023 (GRCm39) missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 114,983,752 (GRCm39) splice site probably benign
R1148:Cyp4x1 UTSW 4 114,983,752 (GRCm39) splice site probably benign
R1426:Cyp4x1 UTSW 4 114,969,988 (GRCm39) splice site probably benign
R1484:Cyp4x1 UTSW 4 114,970,098 (GRCm39) missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 114,984,757 (GRCm39) missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 114,968,867 (GRCm39) missense possibly damaging 0.75
R2208:Cyp4x1 UTSW 4 114,983,791 (GRCm39) missense probably benign 0.01
R2325:Cyp4x1 UTSW 4 114,981,576 (GRCm39) missense probably benign 0.40
R4223:Cyp4x1 UTSW 4 114,970,077 (GRCm39) missense probably damaging 0.98
R4588:Cyp4x1 UTSW 4 114,965,994 (GRCm39) missense probably damaging 1.00
R4717:Cyp4x1 UTSW 4 114,978,902 (GRCm39) missense probably benign 0.02
R5522:Cyp4x1 UTSW 4 114,979,174 (GRCm39) missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 114,965,918 (GRCm39) missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 114,979,142 (GRCm39) missense probably benign
R7733:Cyp4x1 UTSW 4 114,977,391 (GRCm39) missense possibly damaging 0.50
R8113:Cyp4x1 UTSW 4 114,967,263 (GRCm39) missense probably damaging 1.00
R8172:Cyp4x1 UTSW 4 114,968,874 (GRCm39) missense possibly damaging 0.94
R8366:Cyp4x1 UTSW 4 114,970,063 (GRCm39) missense probably benign 0.08
R8766:Cyp4x1 UTSW 4 114,967,262 (GRCm39) missense probably damaging 1.00
R9453:Cyp4x1 UTSW 4 114,991,069 (GRCm39) missense probably damaging 1.00
Z1177:Cyp4x1 UTSW 4 114,984,722 (GRCm39) missense probably damaging 1.00
Z1177:Cyp4x1 UTSW 4 114,967,300 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGACTTTTACACATTTCTGAC -3'
(R):5'- GTAAGACACCAACAGCTTCTTAGG -3'

Sequencing Primer
(F):5'- CTGACTTTTATGTTTGTTTGCCAAG -3'
(R):5'- GCTTTGAAAACTGAAGTTTAAACCC -3'
Posted On 2017-08-16