Incidental Mutation 'R6103:Fbxo6'
ID485365
Institutional Source Beutler Lab
Gene Symbol Fbxo6
Ensembl Gene ENSMUSG00000055401
Gene NameF-box protein 6
SynonymsFbx6b, FBG2, Fbs2, Fbxo6b
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6103 (G1)
Quality Score199.009
Status Validated
Chromosome4
Chromosomal Location148145716-148152140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148149522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000084129] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000126615] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000132698] [ENSMUST00000134261] [ENSMUST00000140049] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472]
Predicted Effect probably damaging
Transcript: ENSMUST00000030858
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030860
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056965
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084129
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105706
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect probably damaging
Transcript: ENSMUST00000126615
AA Change: I39N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120801
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 237 1.39e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132083
AA Change: I39N
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132698
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134261
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140049
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152098
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168503
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183749
Meta Mutation Damage Score 0.8724 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Fbxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Fbxo6 APN 4 148146143 missense probably damaging 1.00
IGL00940:Fbxo6 APN 4 148146110 missense probably benign 0.05
IGL02996:Fbxo6 APN 4 148146891 missense probably damaging 1.00
IGL03034:Fbxo6 APN 4 148146122 nonsense probably null
R0556:Fbxo6 UTSW 4 148146175 missense probably damaging 1.00
R1475:Fbxo6 UTSW 4 148146110 missense probably benign 0.05
R1482:Fbxo6 UTSW 4 148145984 nonsense probably null
R1986:Fbxo6 UTSW 4 148146095 missense probably damaging 1.00
R3742:Fbxo6 UTSW 4 148149633 unclassified probably benign
R4994:Fbxo6 UTSW 4 148149491 missense probably damaging 0.99
R6102:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6104:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6105:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6129:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6130:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6212:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6220:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6392:Fbxo6 UTSW 4 148146005 missense probably benign 0.03
R7997:Fbxo6 UTSW 4 148147395 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGACATTTGTCGTTAGCTAGCG -3'
(R):5'- TTCAGGTCCTCAGCTCACTG -3'

Sequencing Primer
(F):5'- TAAAGAAGGCTCCCAGGGCTC -3'
(R):5'- AGGTCCTCAGCTCACTGTCTTC -3'
Posted On2017-08-16