Incidental Mutation 'R6103:Enam'
ID 485369
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Name enamelin
Synonyms abte
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 88635834-88653908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88650187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 565 (N565K)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
AlphaFold O55196
Predicted Effect probably damaging
Transcript: ENSMUST00000031222
AA Change: N490K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: N490K

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199104
AA Change: N565K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: N565K

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,768,445 (GRCm39) S926P possibly damaging Het
Acacb T A 5: 114,383,942 (GRCm39) M2157K probably damaging Het
Aco2 T C 15: 81,797,452 (GRCm39) V636A probably benign Het
Adgrf3 T C 5: 30,401,265 (GRCm39) Y51C probably damaging Het
Adprhl1 T C 8: 13,272,055 (GRCm39) T1568A possibly damaging Het
Ank1 T A 8: 23,603,999 (GRCm39) S937T probably damaging Het
Ankrd50 T C 3: 38,508,578 (GRCm39) E340G probably damaging Het
Avpr1b C T 1: 131,537,155 (GRCm39) P90S probably damaging Het
Cacna2d3 T C 14: 29,118,446 (GRCm39) H159R probably damaging Het
Carmil3 A T 14: 55,742,884 (GRCm39) T1185S probably benign Het
Casp2 A T 6: 42,256,814 (GRCm39) R357S probably damaging Het
Ccdc34 A G 2: 109,848,352 (GRCm39) D47G probably benign Het
Cd109 A G 9: 78,605,596 (GRCm39) probably null Het
Cd209d T C 8: 3,928,304 (GRCm39) Y27C probably damaging Het
Cep350 T A 1: 155,800,322 (GRCm39) D1176V probably benign Het
Cpd A T 11: 76,690,625 (GRCm39) S844T probably benign Het
Cyp4x1 A G 4: 114,968,864 (GRCm39) L380P probably damaging Het
Dscam A G 16: 96,626,781 (GRCm39) V376A probably benign Het
Fam110c G A 12: 31,124,794 (GRCm39) W252* probably null Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Fgb T C 3: 82,951,170 (GRCm39) D281G probably benign Het
Frem2 T A 3: 53,457,209 (GRCm39) T2048S probably benign Het
Fut8 A T 12: 77,378,721 (GRCm39) probably benign Het
Glmp T C 3: 88,235,338 (GRCm39) S238P probably benign Het
Gm35315 T A 5: 110,226,137 (GRCm39) Y434F probably damaging Het
Gnpnat1 A G 14: 45,620,856 (GRCm39) F71S probably damaging Het
Gpnmb A G 6: 49,019,820 (GRCm39) R64G possibly damaging Het
Grxcr1 T C 5: 68,323,547 (GRCm39) F275S possibly damaging Het
Ift140 T A 17: 25,312,100 (GRCm39) C1314S probably damaging Het
Kif9 T C 9: 110,318,917 (GRCm39) I127T possibly damaging Het
Mmd2 A G 5: 142,553,618 (GRCm39) probably null Het
Ms4a3 A T 19: 11,616,582 (GRCm39) V20D possibly damaging Het
Mtres1 A T 10: 43,408,916 (GRCm39) Y76N probably benign Het
Myh7b A G 2: 155,460,663 (GRCm39) E272G probably damaging Het
Naaladl1 G A 19: 6,158,743 (GRCm39) G292S probably damaging Het
Notch2 T A 3: 98,043,059 (GRCm39) Y1475N possibly damaging Het
Obp2a G A 2: 25,590,163 (GRCm39) E21K probably damaging Het
Or5ar1 A G 2: 85,671,776 (GRCm39) Y120H probably damaging Het
Osbpl10 T A 9: 114,890,940 (GRCm39) Y109* probably null Het
Plcd1 A T 9: 118,901,109 (GRCm39) W749R probably benign Het
Ptpro A G 6: 137,377,704 (GRCm39) E718G possibly damaging Het
Rbm4 C T 19: 4,837,947 (GRCm39) R295H probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Setdb2 T C 14: 59,646,981 (GRCm39) probably null Het
Slc25a18 C A 6: 120,766,399 (GRCm39) L131I probably damaging Het
Slc4a10 A G 2: 62,064,809 (GRCm39) H221R probably damaging Het
Tbc1d32 A T 10: 56,026,979 (GRCm39) W757R probably damaging Het
Tmem183a C A 1: 134,275,884 (GRCm39) V331L probably benign Het
Try10 C A 6: 41,333,484 (GRCm39) H76Q probably damaging Het
Ttn T A 2: 76,748,599 (GRCm39) H4150L probably benign Het
Vmn2r52 G A 7: 9,905,327 (GRCm39) P171S probably benign Het
Vmn2r88 A G 14: 51,652,826 (GRCm39) T450A probably benign Het
Yipf7 A T 5: 69,698,405 (GRCm39) V34D probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zg16 A G 7: 126,649,748 (GRCm39) V71A probably benign Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88,649,343 (GRCm39) missense possibly damaging 0.83
IGL01611:Enam APN 5 88,651,608 (GRCm39) missense probably damaging 0.99
IGL01802:Enam APN 5 88,651,533 (GRCm39) missense possibly damaging 0.93
IGL02220:Enam APN 5 88,652,418 (GRCm39) nonsense probably null
IGL02371:Enam APN 5 88,650,668 (GRCm39) missense probably benign 0.39
IGL02596:Enam APN 5 88,650,885 (GRCm39) missense probably benign 0.01
IGL03026:Enam APN 5 88,651,158 (GRCm39) missense probably benign 0.38
IGL03303:Enam APN 5 88,652,450 (GRCm39) missense probably benign 0.12
opinionated UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
recalcitrant UTSW 5 88,651,650 (GRCm39) nonsense probably null
R0200:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0230:Enam UTSW 5 88,637,514 (GRCm39) splice site probably benign
R0395:Enam UTSW 5 88,649,367 (GRCm39) missense probably damaging 0.99
R0548:Enam UTSW 5 88,650,964 (GRCm39) missense probably damaging 0.96
R0608:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0724:Enam UTSW 5 88,649,853 (GRCm39) missense probably damaging 1.00
R0927:Enam UTSW 5 88,641,919 (GRCm39) missense possibly damaging 0.72
R1023:Enam UTSW 5 88,649,826 (GRCm39) missense probably damaging 0.99
R1053:Enam UTSW 5 88,651,878 (GRCm39) missense possibly damaging 0.64
R1169:Enam UTSW 5 88,651,117 (GRCm39) missense probably damaging 1.00
R1230:Enam UTSW 5 88,641,927 (GRCm39) missense probably damaging 0.99
R1324:Enam UTSW 5 88,641,927 (GRCm39) missense possibly damaging 0.53
R1663:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1727:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1750:Enam UTSW 5 88,651,086 (GRCm39) missense probably damaging 1.00
R1852:Enam UTSW 5 88,652,324 (GRCm39) missense possibly damaging 0.92
R1907:Enam UTSW 5 88,652,481 (GRCm39) missense possibly damaging 0.86
R2104:Enam UTSW 5 88,649,646 (GRCm39) missense probably damaging 1.00
R2143:Enam UTSW 5 88,640,779 (GRCm39) missense probably benign 0.02
R2196:Enam UTSW 5 88,650,603 (GRCm39) missense probably damaging 0.99
R2363:Enam UTSW 5 88,651,008 (GRCm39) missense probably benign 0.24
R2497:Enam UTSW 5 88,650,553 (GRCm39) missense probably benign 0.13
R3615:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3616:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3782:Enam UTSW 5 88,650,674 (GRCm39) missense probably damaging 1.00
R4067:Enam UTSW 5 88,651,236 (GRCm39) missense probably damaging 1.00
R4349:Enam UTSW 5 88,651,407 (GRCm39) missense probably damaging 0.99
R4604:Enam UTSW 5 88,652,142 (GRCm39) missense possibly damaging 0.93
R4649:Enam UTSW 5 88,640,827 (GRCm39) missense probably benign 0.02
R4702:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4703:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4704:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4705:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4714:Enam UTSW 5 88,651,395 (GRCm39) missense probably damaging 1.00
R4748:Enam UTSW 5 88,649,402 (GRCm39) missense probably damaging 1.00
R4838:Enam UTSW 5 88,640,967 (GRCm39) nonsense probably null
R4840:Enam UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
R4856:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4886:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4910:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R4911:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R6651:Enam UTSW 5 88,650,776 (GRCm39) missense probably damaging 0.98
R6759:Enam UTSW 5 88,649,550 (GRCm39) missense probably damaging 1.00
R7282:Enam UTSW 5 88,650,186 (GRCm39) missense probably damaging 0.99
R7365:Enam UTSW 5 88,649,347 (GRCm39) missense possibly damaging 0.75
R7392:Enam UTSW 5 88,649,523 (GRCm39) missense probably damaging 0.99
R7483:Enam UTSW 5 88,649,679 (GRCm39) missense probably damaging 1.00
R7647:Enam UTSW 5 88,650,884 (GRCm39) missense probably benign 0.00
R7648:Enam UTSW 5 88,652,016 (GRCm39) missense possibly damaging 0.89
R7672:Enam UTSW 5 88,651,830 (GRCm39) missense possibly damaging 0.80
R7943:Enam UTSW 5 88,636,410 (GRCm39) splice site probably null
R7999:Enam UTSW 5 88,651,561 (GRCm39) missense probably benign
R8117:Enam UTSW 5 88,651,385 (GRCm39) missense probably benign 0.00
R8419:Enam UTSW 5 88,651,209 (GRCm39) missense possibly damaging 0.80
R8528:Enam UTSW 5 88,650,078 (GRCm39) missense probably damaging 0.98
R8836:Enam UTSW 5 88,639,124 (GRCm39) critical splice donor site probably null
R8973:Enam UTSW 5 88,641,947 (GRCm39) missense possibly damaging 0.96
R9001:Enam UTSW 5 88,637,388 (GRCm39) missense probably benign 0.11
R9033:Enam UTSW 5 88,646,475 (GRCm39) missense probably benign 0.01
R9268:Enam UTSW 5 88,640,778 (GRCm39) missense probably benign 0.01
R9723:Enam UTSW 5 88,652,241 (GRCm39) missense probably damaging 1.00
X0018:Enam UTSW 5 88,650,550 (GRCm39) nonsense probably null
Z1176:Enam UTSW 5 88,640,830 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTCAAATAAACCCTTTGTGG -3'
(R):5'- GGCCTGATTGCTTCTCATAAATG -3'

Sequencing Primer
(F):5'- TCCGGCCTCAAACAAACC -3'
(R):5'- CTCATAAATGGTTTATTTGAGGCCTG -3'
Posted On 2017-08-16