Incidental Mutation 'R6103:Casp2'
ID 485374
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Name caspase 2
Synonyms Nedd2, Caspase-2, Ich-1
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.311) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42264985-42282508 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42279880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 357 (R357S)
Ref Sequence ENSEMBL: ENSMUSP00000031895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000156829]
AlphaFold P29594
Predicted Effect probably damaging
Transcript: ENSMUST00000031895
AA Change: R357S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: R357S

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152893
Predicted Effect probably benign
Transcript: ENSMUST00000156829
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203089
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42269285 nonsense probably null
IGL02094:Casp2 APN 6 42280359 missense probably damaging 1.00
IGL02371:Casp2 APN 6 42267968 missense probably benign 0.00
IGL02414:Casp2 APN 6 42280446 missense probably damaging 1.00
IGL03298:Casp2 APN 6 42268990 splice site probably benign
R1240:Casp2 UTSW 6 42268945 missense probably damaging 1.00
R1424:Casp2 UTSW 6 42276791 splice site probably benign
R1672:Casp2 UTSW 6 42268908 missense probably damaging 1.00
R4110:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R4113:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R5062:Casp2 UTSW 6 42269272 splice site probably benign
R5469:Casp2 UTSW 6 42269334 missense probably benign 0.00
R5835:Casp2 UTSW 6 42267586 missense possibly damaging 0.84
R5877:Casp2 UTSW 6 42276637 intron probably benign
R6667:Casp2 UTSW 6 42279836 missense probably damaging 1.00
R6702:Casp2 UTSW 6 42268051 missense probably benign
R6754:Casp2 UTSW 6 42269330 missense probably damaging 1.00
R7141:Casp2 UTSW 6 42280395 missense possibly damaging 0.68
R7255:Casp2 UTSW 6 42268907 missense probably damaging 1.00
R7611:Casp2 UTSW 6 42274038 missense possibly damaging 0.95
R9135:Casp2 UTSW 6 42268948 missense probably benign 0.03
R9350:Casp2 UTSW 6 42269398 missense probably benign 0.15
X0065:Casp2 UTSW 6 42280143 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTACAGGTTGGAGGCAACAG -3'
(R):5'- GGCAAGCTTCACAAAGTCAGAC -3'

Sequencing Primer
(F):5'- GCTAAAAATGGCTCTTCAGTCGC -3'
(R):5'- GCTTCACAAAGTCAGACTTCTAGTC -3'
Posted On 2017-08-16