Incidental Mutation 'R6103:Gpnmb'
ID485375
Institutional Source Beutler Lab
Gene Symbol Gpnmb
Ensembl Gene ENSMUSG00000029816
Gene Nameglycoprotein (transmembrane) nmb
SynonymsOsteoactivin, Dchil
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location49036546-49070929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49042886 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 64 (R64G)
Ref Sequence ENSEMBL: ENSMUSP00000145376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031840] [ENSMUST00000203757] [ENSMUST00000204260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031840
AA Change: R64G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031840
Gene: ENSMUSG00000029816
AA Change: R64G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203757
Predicted Effect possibly damaging
Transcript: ENSMUST00000204260
AA Change: R64G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816
AA Change: R64G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205103
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit dispersed pigmentation of the iris, deterioration of the posterior iris epithelium and slit-like transillumination defects. The mutation contributes to glaucoma, especially in combination with the brown coat color mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Gpnmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Gpnmb APN 6 49055659 missense probably benign 0.01
IGL01291:Gpnmb APN 6 49055681 missense probably benign 0.12
IGL01307:Gpnmb APN 6 49045365 missense probably benign 0.03
IGL01398:Gpnmb APN 6 49050431 missense probably benign 0.02
IGL01531:Gpnmb APN 6 49047458 splice site probably benign
IGL01936:Gpnmb APN 6 49047450 missense probably null 1.00
ANU05:Gpnmb UTSW 6 49055681 missense probably benign 0.12
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0413:Gpnmb UTSW 6 49042803 missense probably benign
R0690:Gpnmb UTSW 6 49048015 missense probably benign 0.24
R0884:Gpnmb UTSW 6 49047913 missense possibly damaging 0.65
R1659:Gpnmb UTSW 6 49047852 missense probably damaging 1.00
R3703:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R3705:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R4629:Gpnmb UTSW 6 49051060 missense possibly damaging 0.82
R4782:Gpnmb UTSW 6 49045483 splice site probably null
R4799:Gpnmb UTSW 6 49045483 splice site probably null
R4916:Gpnmb UTSW 6 49051970 missense probably damaging 1.00
R5223:Gpnmb UTSW 6 49056205 missense probably benign 0.01
R5390:Gpnmb UTSW 6 49047841 missense probably damaging 1.00
R5512:Gpnmb UTSW 6 49045464 missense possibly damaging 0.62
R5833:Gpnmb UTSW 6 49044018 missense probably damaging 1.00
R7211:Gpnmb UTSW 6 49052015 missense possibly damaging 0.82
R7900:Gpnmb UTSW 6 49050466 missense possibly damaging 0.83
R7983:Gpnmb UTSW 6 49050466 missense possibly damaging 0.83
Z1176:Gpnmb UTSW 6 49051832 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGCATGTGCTTCCCAATG -3'
(R):5'- CTTCAGAAAGTGGAGCTGTTGAG -3'

Sequencing Primer
(F):5'- GCATGTGCTTCCCAATGATTGAAATG -3'
(R):5'- GGGAGGAGGGAAGCTTGCC -3'
Posted On2017-08-16