Incidental Mutation 'R6103:Cd109'
ID485384
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene NameCD109 antigen
SynonymsGov platelet alloantigens, 9930012E15Rik
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78615546-78716253 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 78698314 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
Predicted Effect probably null
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAAGGCTGTCAGCATTTG -3'
(R):5'- GCGTCCCCTAAGAATGGGTTAC -3'

Sequencing Primer
(F):5'- CCAAGGCTGTCAGCATTTGTTTTAAG -3'
(R):5'- CCCCTAAGAATGGGTTACTATTTTTC -3'
Posted On2017-08-16