Mutagenetix > Incidental Mutations

Incidental Mutation 'R6103:Cd109'

485384

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

MMRRC Submission

044253-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 78698314 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

Predicted Effect

probably null
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	A	T	10: 43,532,920	Y76N	probably benign	Het
Abcc8	A	G	7: 46,119,021	S926P	possibly damaging	Het
Acacb	T	A	5: 114,245,881	M2157K	probably damaging	Het
Aco2	T	C	15: 81,913,251	V636A	probably benign	Het
Adgrf3	T	C	5: 30,196,267	Y51C	probably damaging	Het
Adprhl1	T	C	8: 13,222,055	T1568A	possibly damaging	Het
Ank1	T	A	8: 23,113,983	S937T	probably damaging	Het
Ankrd50	T	C	3: 38,454,429	E340G	probably damaging	Het
Avpr1b	C	T	1: 131,609,417	P90S	probably damaging	Het
Cacna2d3	T	C	14: 29,396,489	H159R	probably damaging	Het
Carmil3	A	T	14: 55,505,427	T1185S	probably benign	Het
Casp2	A	T	6: 42,279,880	R357S	probably damaging	Het
Ccdc34	A	G	2: 110,018,007	D47G	probably benign	Het
Cd209d	T	C	8: 3,878,304	Y27C	probably damaging	Het
Cep350	T	A	1: 155,924,576	D1176V	probably benign	Het
Cpd	A	T	11: 76,799,799	S844T	probably benign	Het
Cyp4x1	A	G	4: 115,111,667	L380P	probably damaging	Het
Dscam	A	G	16: 96,825,581	V376A	probably benign	Het
Enam	T	A	5: 88,502,328	N565K	probably damaging	Het
Fam110c	G	A	12: 31,074,795	W252*	probably null	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Fgb	T	C	3: 83,043,863	D281G	probably benign	Het
Frem2	T	A	3: 53,549,788	T2048S	probably benign	Het
Fut8	A	T	12: 77,331,947		probably benign	Het
Glmp	T	C	3: 88,328,031	S238P	probably benign	Het
Gm35315	T	A	5: 110,078,271	Y434F	probably damaging	Het
Gnpnat1	A	G	14: 45,383,399	F71S	probably damaging	Het
Gpnmb	A	G	6: 49,042,886	R64G	possibly damaging	Het
Grxcr1	T	C	5: 68,166,204	F275S	possibly damaging	Het
Ift140	T	A	17: 25,093,126	C1314S	probably damaging	Het
Kif9	T	C	9: 110,489,849	I127T	possibly damaging	Het
Mmd2	A	G	5: 142,567,863		probably null	Het
Ms4a3	A	T	19: 11,639,218	V20D	possibly damaging	Het
Myh7b	A	G	2: 155,618,743	E272G	probably damaging	Het
Naaladl1	G	A	19: 6,108,713	G292S	probably damaging	Het
Notch2	T	A	3: 98,135,743	Y1475N	possibly damaging	Het
Obp2a	G	A	2: 25,700,151	E21K	probably damaging	Het
Olfr1019	A	G	2: 85,841,432	Y120H	probably damaging	Het
Osbpl10	T	A	9: 115,061,872	Y109*	probably null	Het
Plcd1	A	T	9: 119,072,041	W749R	probably benign	Het
Ptpro	A	G	6: 137,400,706	E718G	possibly damaging	Het
Rbm4	C	T	19: 4,787,919	R295H	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Setdb2	T	C	14: 59,409,532		probably null	Het
Slc25a18	C	A	6: 120,789,438	L131I	probably damaging	Het
Slc4a10	A	G	2: 62,234,465	H221R	probably damaging	Het
Tbc1d32	A	T	10: 56,150,883	W757R	probably damaging	Het
Tmem183a	C	A	1: 134,348,146	V331L	probably benign	Het
Try10	C	A	6: 41,356,550	H76Q	probably damaging	Het
Ttn	T	A	2: 76,918,255	H4150L	probably benign	Het
Vmn2r52	G	A	7: 10,171,400	P171S	probably benign	Het
Vmn2r88	A	G	14: 51,415,369	T450A	probably benign	Het
Yipf7	A	T	5: 69,541,062	V34D	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zg16	A	G	7: 127,050,576	V71A	probably benign	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCAAGGCTGTCAGCATTTG -3'
(R):5'- GCGTCCCCTAAGAATGGGTTAC -3'

Sequencing Primer
(F):5'- CCAAGGCTGTCAGCATTTGTTTTAAG -3'
(R):5'- CCCCTAAGAATGGGTTACTATTTTTC -3'

Posted On

2017-08-16