Incidental Mutation 'R6103:Osbpl10'
ID485386
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115061872 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Ref Sequence ENSEMBL: ENSMUSP00000138287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000182920] [ENSMUST00000183104] [ENSMUST00000183141]
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182384
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182920
Predicted Effect probably null
Transcript: ENSMUST00000183104
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875
AA Change: Y109*

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183141
SMART Domains Protein: ENSMUSP00000138760
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 3e-18 BLAST
PDB:2D9X|A 2 46 6e-8 PDB
SCOP:d1ki1b2 10 42 9e-4 SMART
low complexity region 131 152 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R0948:Osbpl10 UTSW 9 115167119 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4406:Osbpl10 UTSW 9 115109481 missense probably damaging 0.96
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 unclassified probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7008:Osbpl10 UTSW 9 115061848 missense probably damaging 1.00
R7027:Osbpl10 UTSW 9 115223698 missense probably damaging 0.97
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7905:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
R7936:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7988:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGATCCTCTCTGCTATCACAG -3'
(R):5'- GTATCTCCCCACAGAAGAGC -3'

Sequencing Primer
(F):5'- TGCTATCACAGTTGATACCCTATTG -3'
(R):5'- ACAACACTGTGCAGCTGTTG -3'
Posted On2017-08-16