Incidental Mutation 'R6103:Plcd1'
ID485387
Institutional Source Beutler Lab
Gene Symbol Plcd1
Ensembl Gene ENSMUSG00000010660
Gene Namephospholipase C, delta 1
SynonymsPLC-delta 1
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119071527-119093502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119072041 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 749 (W749R)
Ref Sequence ENSEMBL: ENSMUSP00000149813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
Predicted Effect probably benign
Transcript: ENSMUST00000010804
AA Change: W723R

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: W723R

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Predicted Effect probably benign
Transcript: ENSMUST00000213464
Predicted Effect probably benign
Transcript: ENSMUST00000214470
AA Change: W749R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214491
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Plcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Plcd1 APN 9 119076178 missense probably damaging 1.00
IGL01634:Plcd1 APN 9 119073789 missense probably damaging 0.99
IGL01992:Plcd1 APN 9 119075985 missense probably benign
IGL02246:Plcd1 APN 9 119072609 missense probably benign 0.16
IGL02266:Plcd1 APN 9 119074787 splice site probably benign
IGL02270:Plcd1 APN 9 119084641 missense probably damaging 1.00
IGL02281:Plcd1 APN 9 119074773 missense probably benign 0.00
IGL02324:Plcd1 APN 9 119072642 missense probably damaging 0.97
IGL02936:Plcd1 APN 9 119074199 missense probably damaging 1.00
IGL03348:Plcd1 APN 9 119072490 missense possibly damaging 0.91
R0366:Plcd1 UTSW 9 119081136 missense probably damaging 0.99
R1765:Plcd1 UTSW 9 119071806 missense probably damaging 1.00
R3704:Plcd1 UTSW 9 119076209 missense possibly damaging 0.85
R5143:Plcd1 UTSW 9 119074451 nonsense probably null
R5587:Plcd1 UTSW 9 119073832 missense probably benign
R5877:Plcd1 UTSW 9 119076172 missense probably damaging 1.00
R6043:Plcd1 UTSW 9 119072599 missense probably damaging 1.00
R6338:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6339:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6496:Plcd1 UTSW 9 119072641 missense possibly damaging 0.79
R6516:Plcd1 UTSW 9 119076203 missense probably damaging 0.99
R6646:Plcd1 UTSW 9 119075032 missense probably damaging 0.99
R6854:Plcd1 UTSW 9 119074321 splice site probably null
R6955:Plcd1 UTSW 9 119071856 missense probably benign 0.01
R7382:Plcd1 UTSW 9 119074691 missense probably damaging 1.00
R7577:Plcd1 UTSW 9 119072254 missense possibly damaging 0.94
R7922:Plcd1 UTSW 9 119074652 missense possibly damaging 0.64
R8089:Plcd1 UTSW 9 119075992 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTGGATGGAGATCTTCACAAAG -3'
(R):5'- TTGACTTTGCTGCTCATACGG -3'

Sequencing Primer
(F):5'- CAGGTCTCCATTCTTAGACAAGAGG -3'
(R):5'- GCTGCTCATACGGTTTTTGC -3'
Posted On2017-08-16