Incidental Mutation 'R6103:Cpd'
ID485390
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Namecarboxypeptidase D
SynonymsD830034L15Rik
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76778424-76847018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76799799 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 844 (S844T)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
Predicted Effect probably benign
Transcript: ENSMUST00000021201
AA Change: S844T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: S844T

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGCCTATGACAGTGC -3'
(R):5'- CCCAAAGTAATTAGATGGGCTTTTCC -3'

Sequencing Primer
(F):5'- GCCTATGACAGTGCAATGC -3'
(R):5'- GGCTTTTCCCCTTAAAATCTGG -3'
Posted On2017-08-16