Incidental Mutation 'R6103:Vmn2r88'
ID 485395
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51652826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 450 (T450A)
Ref Sequence ENSEMBL: ENSMUSP00000022438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: T450A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: T450A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159674
AA Change: T442A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: T442A

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: T442A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,768,445 (GRCm39) S926P possibly damaging Het
Acacb T A 5: 114,383,942 (GRCm39) M2157K probably damaging Het
Aco2 T C 15: 81,797,452 (GRCm39) V636A probably benign Het
Adgrf3 T C 5: 30,401,265 (GRCm39) Y51C probably damaging Het
Adprhl1 T C 8: 13,272,055 (GRCm39) T1568A possibly damaging Het
Ank1 T A 8: 23,603,999 (GRCm39) S937T probably damaging Het
Ankrd50 T C 3: 38,508,578 (GRCm39) E340G probably damaging Het
Avpr1b C T 1: 131,537,155 (GRCm39) P90S probably damaging Het
Cacna2d3 T C 14: 29,118,446 (GRCm39) H159R probably damaging Het
Carmil3 A T 14: 55,742,884 (GRCm39) T1185S probably benign Het
Casp2 A T 6: 42,256,814 (GRCm39) R357S probably damaging Het
Ccdc34 A G 2: 109,848,352 (GRCm39) D47G probably benign Het
Cd109 A G 9: 78,605,596 (GRCm39) probably null Het
Cd209d T C 8: 3,928,304 (GRCm39) Y27C probably damaging Het
Cep350 T A 1: 155,800,322 (GRCm39) D1176V probably benign Het
Cpd A T 11: 76,690,625 (GRCm39) S844T probably benign Het
Cyp4x1 A G 4: 114,968,864 (GRCm39) L380P probably damaging Het
Dscam A G 16: 96,626,781 (GRCm39) V376A probably benign Het
Enam T A 5: 88,650,187 (GRCm39) N565K probably damaging Het
Fam110c G A 12: 31,124,794 (GRCm39) W252* probably null Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Fgb T C 3: 82,951,170 (GRCm39) D281G probably benign Het
Frem2 T A 3: 53,457,209 (GRCm39) T2048S probably benign Het
Fut8 A T 12: 77,378,721 (GRCm39) probably benign Het
Glmp T C 3: 88,235,338 (GRCm39) S238P probably benign Het
Gm35315 T A 5: 110,226,137 (GRCm39) Y434F probably damaging Het
Gnpnat1 A G 14: 45,620,856 (GRCm39) F71S probably damaging Het
Gpnmb A G 6: 49,019,820 (GRCm39) R64G possibly damaging Het
Grxcr1 T C 5: 68,323,547 (GRCm39) F275S possibly damaging Het
Ift140 T A 17: 25,312,100 (GRCm39) C1314S probably damaging Het
Kif9 T C 9: 110,318,917 (GRCm39) I127T possibly damaging Het
Mmd2 A G 5: 142,553,618 (GRCm39) probably null Het
Ms4a3 A T 19: 11,616,582 (GRCm39) V20D possibly damaging Het
Mtres1 A T 10: 43,408,916 (GRCm39) Y76N probably benign Het
Myh7b A G 2: 155,460,663 (GRCm39) E272G probably damaging Het
Naaladl1 G A 19: 6,158,743 (GRCm39) G292S probably damaging Het
Notch2 T A 3: 98,043,059 (GRCm39) Y1475N possibly damaging Het
Obp2a G A 2: 25,590,163 (GRCm39) E21K probably damaging Het
Or5ar1 A G 2: 85,671,776 (GRCm39) Y120H probably damaging Het
Osbpl10 T A 9: 114,890,940 (GRCm39) Y109* probably null Het
Plcd1 A T 9: 118,901,109 (GRCm39) W749R probably benign Het
Ptpro A G 6: 137,377,704 (GRCm39) E718G possibly damaging Het
Rbm4 C T 19: 4,837,947 (GRCm39) R295H probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Setdb2 T C 14: 59,646,981 (GRCm39) probably null Het
Slc25a18 C A 6: 120,766,399 (GRCm39) L131I probably damaging Het
Slc4a10 A G 2: 62,064,809 (GRCm39) H221R probably damaging Het
Tbc1d32 A T 10: 56,026,979 (GRCm39) W757R probably damaging Het
Tmem183a C A 1: 134,275,884 (GRCm39) V331L probably benign Het
Try10 C A 6: 41,333,484 (GRCm39) H76Q probably damaging Het
Ttn T A 2: 76,748,599 (GRCm39) H4150L probably benign Het
Vmn2r52 G A 7: 9,905,327 (GRCm39) P171S probably benign Het
Yipf7 A T 5: 69,698,405 (GRCm39) V34D probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zg16 A G 7: 126,649,748 (GRCm39) V71A probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51,656,007 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51,650,665 (GRCm39) missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7552:Vmn2r88 UTSW 14 51,648,315 (GRCm39) splice site probably null
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8859:Vmn2r88 UTSW 14 51,656,263 (GRCm39) missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9311:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CACACACCATGTTACTTGTTATCTG -3'
(R):5'- ACTGATGTTCCTCCCATGGC -3'

Sequencing Primer
(F):5'- ACCATGTTACTTGTTATCTGGTAATC -3'
(R):5'- GCCCATTCCAAATCATCAGATATATG -3'
Posted On 2017-08-16