Mutagenetix > Incidental Mutations

Incidental Mutation 'R6103:Carmil3'

485396

Institutional Source

Beutler Lab

Gene Symbol

Carmil3

Ensembl Gene

ENSMUSG00000022211

Gene Name

capping protein regulator and myosin 1 linker 3

Synonyms

Lrrc16b

MMRRC Submission

044253-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R6103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55490651-55508272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55505427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1185 (T1185S)

Ref Sequence

ENSEMBL: ENSMUSP00000075587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]

AlphaFold

Q3UFQ8

Predicted Effect

probably benign
Transcript: ENSMUST00000076236
AA Change: T1185S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: T1185S

Domain	Start	End	E-Value	Type
low complexity region	138	151	N/A	INTRINSIC
internal_repeat_1	203	297	7.56e-6	PROSPERO
Blast:LRR	333	362	5e-10	BLAST
Blast:LRR	423	446	1e-5	BLAST
low complexity region	447	462	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC
internal_repeat_1	496	593	7.56e-6	PROSPERO
Pfam:CARMIL_C	778	1065	5.3e-76	PFAM
low complexity region	1068	1117	N/A	INTRINSIC
low complexity region	1137	1146	N/A	INTRINSIC
low complexity region	1204	1216	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226653

Predicted Effect

probably benign
Transcript: ENSMUST00000226757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227088

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228760

Predicted Effect

probably benign
Transcript: ENSMUST00000228877

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	A	T	10: 43,532,920	Y76N	probably benign	Het
Abcc8	A	G	7: 46,119,021	S926P	possibly damaging	Het
Acacb	T	A	5: 114,245,881	M2157K	probably damaging	Het
Aco2	T	C	15: 81,913,251	V636A	probably benign	Het
Adgrf3	T	C	5: 30,196,267	Y51C	probably damaging	Het
Adprhl1	T	C	8: 13,222,055	T1568A	possibly damaging	Het
Ank1	T	A	8: 23,113,983	S937T	probably damaging	Het
Ankrd50	T	C	3: 38,454,429	E340G	probably damaging	Het
Avpr1b	C	T	1: 131,609,417	P90S	probably damaging	Het
Cacna2d3	T	C	14: 29,396,489	H159R	probably damaging	Het
Casp2	A	T	6: 42,279,880	R357S	probably damaging	Het
Ccdc34	A	G	2: 110,018,007	D47G	probably benign	Het
Cd109	A	G	9: 78,698,314		probably null	Het
Cd209d	T	C	8: 3,878,304	Y27C	probably damaging	Het
Cep350	T	A	1: 155,924,576	D1176V	probably benign	Het
Cpd	A	T	11: 76,799,799	S844T	probably benign	Het
Cyp4x1	A	G	4: 115,111,667	L380P	probably damaging	Het
Dscam	A	G	16: 96,825,581	V376A	probably benign	Het
Enam	T	A	5: 88,502,328	N565K	probably damaging	Het
Fam110c	G	A	12: 31,074,795	W252*	probably null	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Fgb	T	C	3: 83,043,863	D281G	probably benign	Het
Frem2	T	A	3: 53,549,788	T2048S	probably benign	Het
Fut8	A	T	12: 77,331,947		probably benign	Het
Glmp	T	C	3: 88,328,031	S238P	probably benign	Het
Gm35315	T	A	5: 110,078,271	Y434F	probably damaging	Het
Gnpnat1	A	G	14: 45,383,399	F71S	probably damaging	Het
Gpnmb	A	G	6: 49,042,886	R64G	possibly damaging	Het
Grxcr1	T	C	5: 68,166,204	F275S	possibly damaging	Het
Ift140	T	A	17: 25,093,126	C1314S	probably damaging	Het
Kif9	T	C	9: 110,489,849	I127T	possibly damaging	Het
Mmd2	A	G	5: 142,567,863		probably null	Het
Ms4a3	A	T	19: 11,639,218	V20D	possibly damaging	Het
Myh7b	A	G	2: 155,618,743	E272G	probably damaging	Het
Naaladl1	G	A	19: 6,108,713	G292S	probably damaging	Het
Notch2	T	A	3: 98,135,743	Y1475N	possibly damaging	Het
Obp2a	G	A	2: 25,700,151	E21K	probably damaging	Het
Olfr1019	A	G	2: 85,841,432	Y120H	probably damaging	Het
Osbpl10	T	A	9: 115,061,872	Y109*	probably null	Het
Plcd1	A	T	9: 119,072,041	W749R	probably benign	Het
Ptpro	A	G	6: 137,400,706	E718G	possibly damaging	Het
Rbm4	C	T	19: 4,787,919	R295H	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Setdb2	T	C	14: 59,409,532		probably null	Het
Slc25a18	C	A	6: 120,789,438	L131I	probably damaging	Het
Slc4a10	A	G	2: 62,234,465	H221R	probably damaging	Het
Tbc1d32	A	T	10: 56,150,883	W757R	probably damaging	Het
Tmem183a	C	A	1: 134,348,146	V331L	probably benign	Het
Try10	C	A	6: 41,356,550	H76Q	probably damaging	Het
Ttn	T	A	2: 76,918,255	H4150L	probably benign	Het
Vmn2r52	G	A	7: 10,171,400	P171S	probably benign	Het
Vmn2r88	A	G	14: 51,415,369	T450A	probably benign	Het
Yipf7	A	T	5: 69,541,062	V34D	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zg16	A	G	7: 127,050,576	V71A	probably benign	Het

Other mutations in Carmil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Carmil3	APN	14	55498298	missense	probably damaging	0.99
IGL00498:Carmil3	APN	14	55501895	critical splice donor site	probably null
IGL01061:Carmil3	APN	14	55498630	missense	possibly damaging	0.67
IGL01452:Carmil3	APN	14	55496058	missense	probably damaging	0.99
IGL01606:Carmil3	APN	14	55493849	missense	possibly damaging	0.83
IGL01633:Carmil3	APN	14	55494227	missense	possibly damaging	0.84
IGL01977:Carmil3	APN	14	55493536	missense	probably damaging	1.00
IGL02065:Carmil3	APN	14	55493822	splice site	probably benign
IGL02160:Carmil3	APN	14	55493558	missense	possibly damaging	0.70
IGL02491:Carmil3	APN	14	55504517	missense	probably benign	0.00
IGL02567:Carmil3	APN	14	55498882	missense	possibly damaging	0.93
IGL02629:Carmil3	APN	14	55499068	missense	probably damaging	0.97
IGL02720:Carmil3	APN	14	55507410	missense	probably damaging	0.97
IGL03100:Carmil3	APN	14	55494718	missense	probably damaging	0.99
PIT4434001:Carmil3	UTSW	14	55494688	missense	probably null	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0027:Carmil3	UTSW	14	55494403	missense	probably damaging	0.96
R0101:Carmil3	UTSW	14	55497755	splice site	probably benign
R0321:Carmil3	UTSW	14	55502241	missense	possibly damaging	0.63
R0370:Carmil3	UTSW	14	55495442	missense	possibly damaging	0.82
R0465:Carmil3	UTSW	14	55499861	missense	probably damaging	0.99
R0647:Carmil3	UTSW	14	55502435	critical splice donor site	probably null
R1503:Carmil3	UTSW	14	55498280	missense	probably damaging	0.96
R1635:Carmil3	UTSW	14	55496282	missense	possibly damaging	0.91
R1715:Carmil3	UTSW	14	55504532	missense	probably benign	0.02
R1923:Carmil3	UTSW	14	55502404	missense	probably damaging	0.99
R1944:Carmil3	UTSW	14	55498630	missense	probably damaging	0.97
R2513:Carmil3	UTSW	14	55503838	missense	probably damaging	0.98
R2892:Carmil3	UTSW	14	55498313	missense	probably damaging	0.96
R3433:Carmil3	UTSW	14	55507694	missense	probably benign	0.05
R3552:Carmil3	UTSW	14	55507402	missense	possibly damaging	0.86
R3783:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R3787:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R4181:Carmil3	UTSW	14	55503955	missense	probably benign	0.10
R4285:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4420:Carmil3	UTSW	14	55493588	missense	probably damaging	0.98
R4424:Carmil3	UTSW	14	55501471	missense	probably benign
R4506:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4507:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4534:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4535:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4549:Carmil3	UTSW	14	55505664	splice site	probably null
R4574:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4783:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R4784:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R5146:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
R5279:Carmil3	UTSW	14	55501571	missense	probably damaging	0.98
R5425:Carmil3	UTSW	14	55493877	missense	probably benign	0.41
R5530:Carmil3	UTSW	14	55493624	missense	probably damaging	0.98
R5534:Carmil3	UTSW	14	55494890	missense	probably damaging	0.97
R5598:Carmil3	UTSW	14	55503999	frame shift	probably null
R5772:Carmil3	UTSW	14	55493239	missense	probably damaging	1.00
R5896:Carmil3	UTSW	14	55503999	frame shift	probably null
R5931:Carmil3	UTSW	14	55498940	missense	probably damaging	0.99
R6048:Carmil3	UTSW	14	55503845	missense	probably benign	0.00
R6258:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6260:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6338:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6339:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6646:Carmil3	UTSW	14	55507930	missense	probably damaging	0.97
R6936:Carmil3	UTSW	14	55501561	missense	probably benign	0.04
R7164:Carmil3	UTSW	14	55501282	missense	probably damaging	0.98
R7214:Carmil3	UTSW	14	55498612	missense	probably damaging	1.00
R7223:Carmil3	UTSW	14	55496238	missense	possibly damaging	0.48
R7269:Carmil3	UTSW	14	55493895	missense	probably benign	0.03
R7319:Carmil3	UTSW	14	55494360	missense	probably benign	0.13
R7357:Carmil3	UTSW	14	55491133	start gained	probably benign
R7386:Carmil3	UTSW	14	55497747	critical splice donor site	probably null
R7463:Carmil3	UTSW	14	55502396	missense	probably damaging	1.00
R7598:Carmil3	UTSW	14	55494821	missense	possibly damaging	0.61
R7602:Carmil3	UTSW	14	55501508	missense	probably null	0.00
R7617:Carmil3	UTSW	14	55497891	missense	probably benign	0.06
R7985:Carmil3	UTSW	14	55496952	missense	probably benign	0.03
R8127:Carmil3	UTSW	14	55498244	missense	probably damaging	0.98
R8423:Carmil3	UTSW	14	55499065	missense	probably damaging	1.00
R8465:Carmil3	UTSW	14	55496848	missense	probably damaging	1.00
R8849:Carmil3	UTSW	14	55497170	missense	probably benign	0.01
R8955:Carmil3	UTSW	14	55496077	missense	probably damaging	0.98
R9321:Carmil3	UTSW	14	55503968	missense
R9346:Carmil3	UTSW	14	55494684	missense	probably damaging	1.00
R9387:Carmil3	UTSW	14	55494412	nonsense	probably null
U24488:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
Z1088:Carmil3	UTSW	14	55501568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCACAAGGTGATATGGGTAC -3'
(R):5'- ACGTACCTATGTGCCACGTG -3'

Sequencing Primer
(F):5'- CCCACAAGGTGATATGGGTACTAGTC -3'
(R):5'- GCATGGCGCTGAAGCTTG -3'

Posted On

2017-08-16