Incidental Mutation 'R6103:Setdb2'
ID 485397
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 59646981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably null
Transcript: ENSMUST00000095775
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159640
Predicted Effect probably null
Transcript: ENSMUST00000161459
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,768,445 (GRCm39) S926P possibly damaging Het
Acacb T A 5: 114,383,942 (GRCm39) M2157K probably damaging Het
Aco2 T C 15: 81,797,452 (GRCm39) V636A probably benign Het
Adgrf3 T C 5: 30,401,265 (GRCm39) Y51C probably damaging Het
Adprhl1 T C 8: 13,272,055 (GRCm39) T1568A possibly damaging Het
Ank1 T A 8: 23,603,999 (GRCm39) S937T probably damaging Het
Ankrd50 T C 3: 38,508,578 (GRCm39) E340G probably damaging Het
Avpr1b C T 1: 131,537,155 (GRCm39) P90S probably damaging Het
Cacna2d3 T C 14: 29,118,446 (GRCm39) H159R probably damaging Het
Carmil3 A T 14: 55,742,884 (GRCm39) T1185S probably benign Het
Casp2 A T 6: 42,256,814 (GRCm39) R357S probably damaging Het
Ccdc34 A G 2: 109,848,352 (GRCm39) D47G probably benign Het
Cd109 A G 9: 78,605,596 (GRCm39) probably null Het
Cd209d T C 8: 3,928,304 (GRCm39) Y27C probably damaging Het
Cep350 T A 1: 155,800,322 (GRCm39) D1176V probably benign Het
Cpd A T 11: 76,690,625 (GRCm39) S844T probably benign Het
Cyp4x1 A G 4: 114,968,864 (GRCm39) L380P probably damaging Het
Dscam A G 16: 96,626,781 (GRCm39) V376A probably benign Het
Enam T A 5: 88,650,187 (GRCm39) N565K probably damaging Het
Fam110c G A 12: 31,124,794 (GRCm39) W252* probably null Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Fgb T C 3: 82,951,170 (GRCm39) D281G probably benign Het
Frem2 T A 3: 53,457,209 (GRCm39) T2048S probably benign Het
Fut8 A T 12: 77,378,721 (GRCm39) probably benign Het
Glmp T C 3: 88,235,338 (GRCm39) S238P probably benign Het
Gm35315 T A 5: 110,226,137 (GRCm39) Y434F probably damaging Het
Gnpnat1 A G 14: 45,620,856 (GRCm39) F71S probably damaging Het
Gpnmb A G 6: 49,019,820 (GRCm39) R64G possibly damaging Het
Grxcr1 T C 5: 68,323,547 (GRCm39) F275S possibly damaging Het
Ift140 T A 17: 25,312,100 (GRCm39) C1314S probably damaging Het
Kif9 T C 9: 110,318,917 (GRCm39) I127T possibly damaging Het
Mmd2 A G 5: 142,553,618 (GRCm39) probably null Het
Ms4a3 A T 19: 11,616,582 (GRCm39) V20D possibly damaging Het
Mtres1 A T 10: 43,408,916 (GRCm39) Y76N probably benign Het
Myh7b A G 2: 155,460,663 (GRCm39) E272G probably damaging Het
Naaladl1 G A 19: 6,158,743 (GRCm39) G292S probably damaging Het
Notch2 T A 3: 98,043,059 (GRCm39) Y1475N possibly damaging Het
Obp2a G A 2: 25,590,163 (GRCm39) E21K probably damaging Het
Or5ar1 A G 2: 85,671,776 (GRCm39) Y120H probably damaging Het
Osbpl10 T A 9: 114,890,940 (GRCm39) Y109* probably null Het
Plcd1 A T 9: 118,901,109 (GRCm39) W749R probably benign Het
Ptpro A G 6: 137,377,704 (GRCm39) E718G possibly damaging Het
Rbm4 C T 19: 4,837,947 (GRCm39) R295H probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Slc25a18 C A 6: 120,766,399 (GRCm39) L131I probably damaging Het
Slc4a10 A G 2: 62,064,809 (GRCm39) H221R probably damaging Het
Tbc1d32 A T 10: 56,026,979 (GRCm39) W757R probably damaging Het
Tmem183a C A 1: 134,275,884 (GRCm39) V331L probably benign Het
Try10 C A 6: 41,333,484 (GRCm39) H76Q probably damaging Het
Ttn T A 2: 76,748,599 (GRCm39) H4150L probably benign Het
Vmn2r52 G A 7: 9,905,327 (GRCm39) P171S probably benign Het
Vmn2r88 A G 14: 51,652,826 (GRCm39) T450A probably benign Het
Yipf7 A T 5: 69,698,405 (GRCm39) V34D probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zg16 A G 7: 126,649,748 (GRCm39) V71A probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCTTTCCTGGGACTTCAAG -3'
(R):5'- GTTCGAAGCTGGGCACATATG -3'

Sequencing Primer
(F):5'- CTGGGACTTCAAGCACCTGTTTAG -3'
(R):5'- CAGCAGTTCTCTGTATGAGTCAG -3'
Posted On 2017-08-16