Mutagenetix > Incidental Mutation

Incidental Mutation 'R6103:Setdb2'

485397

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

044253-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R6103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 59409532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably null
Transcript: ENSMUST00000095775

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159640

Predicted Effect

probably null
Transcript: ENSMUST00000161459

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	A	T	10: 43,532,920	Y76N	probably benign	Het
Abcc8	A	G	7: 46,119,021	S926P	possibly damaging	Het
Acacb	T	A	5: 114,245,881	M2157K	probably damaging	Het
Aco2	T	C	15: 81,913,251	V636A	probably benign	Het
Adgrf3	T	C	5: 30,196,267	Y51C	probably damaging	Het
Adprhl1	T	C	8: 13,222,055	T1568A	possibly damaging	Het
Ank1	T	A	8: 23,113,983	S937T	probably damaging	Het
Ankrd50	T	C	3: 38,454,429	E340G	probably damaging	Het
Avpr1b	C	T	1: 131,609,417	P90S	probably damaging	Het
Cacna2d3	T	C	14: 29,396,489	H159R	probably damaging	Het
Carmil3	A	T	14: 55,505,427	T1185S	probably benign	Het
Casp2	A	T	6: 42,279,880	R357S	probably damaging	Het
Ccdc34	A	G	2: 110,018,007	D47G	probably benign	Het
Cd109	A	G	9: 78,698,314		probably null	Het
Cd209d	T	C	8: 3,878,304	Y27C	probably damaging	Het
Cep350	T	A	1: 155,924,576	D1176V	probably benign	Het
Cpd	A	T	11: 76,799,799	S844T	probably benign	Het
Cyp4x1	A	G	4: 115,111,667	L380P	probably damaging	Het
Dscam	A	G	16: 96,825,581	V376A	probably benign	Het
Enam	T	A	5: 88,502,328	N565K	probably damaging	Het
Fam110c	G	A	12: 31,074,795	W252*	probably null	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Fgb	T	C	3: 83,043,863	D281G	probably benign	Het
Frem2	T	A	3: 53,549,788	T2048S	probably benign	Het
Fut8	A	T	12: 77,331,947		probably benign	Het
Glmp	T	C	3: 88,328,031	S238P	probably benign	Het
Gm35315	T	A	5: 110,078,271	Y434F	probably damaging	Het
Gnpnat1	A	G	14: 45,383,399	F71S	probably damaging	Het
Gpnmb	A	G	6: 49,042,886	R64G	possibly damaging	Het
Grxcr1	T	C	5: 68,166,204	F275S	possibly damaging	Het
Ift140	T	A	17: 25,093,126	C1314S	probably damaging	Het
Kif9	T	C	9: 110,489,849	I127T	possibly damaging	Het
Mmd2	A	G	5: 142,567,863		probably null	Het
Ms4a3	A	T	19: 11,639,218	V20D	possibly damaging	Het
Myh7b	A	G	2: 155,618,743	E272G	probably damaging	Het
Naaladl1	G	A	19: 6,108,713	G292S	probably damaging	Het
Notch2	T	A	3: 98,135,743	Y1475N	possibly damaging	Het
Obp2a	G	A	2: 25,700,151	E21K	probably damaging	Het
Olfr1019	A	G	2: 85,841,432	Y120H	probably damaging	Het
Osbpl10	T	A	9: 115,061,872	Y109*	probably null	Het
Plcd1	A	T	9: 119,072,041	W749R	probably benign	Het
Ptpro	A	G	6: 137,400,706	E718G	possibly damaging	Het
Rbm4	C	T	19: 4,787,919	R295H	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Slc25a18	C	A	6: 120,789,438	L131I	probably damaging	Het
Slc4a10	A	G	2: 62,234,465	H221R	probably damaging	Het
Tbc1d32	A	T	10: 56,150,883	W757R	probably damaging	Het
Tmem183a	C	A	1: 134,348,146	V331L	probably benign	Het
Try10	C	A	6: 41,356,550	H76Q	probably damaging	Het
Ttn	T	A	2: 76,918,255	H4150L	probably benign	Het
Vmn2r52	G	A	7: 10,171,400	P171S	probably benign	Het
Vmn2r88	A	G	14: 51,415,369	T450A	probably benign	Het
Yipf7	A	T	5: 69,541,062	V34D	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zg16	A	G	7: 127,050,576	V71A	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTCTTTCCTGGGACTTCAAG -3'
(R):5'- GTTCGAAGCTGGGCACATATG -3'

Sequencing Primer
(F):5'- CTGGGACTTCAAGCACCTGTTTAG -3'
(R):5'- CAGCAGTTCTCTGTATGAGTCAG -3'

Posted On

2017-08-16