Incidental Mutation 'R6103:Aco2'
ID485399
Institutional Source Beutler Lab
Gene Symbol Aco2
Ensembl Gene ENSMUSG00000022477
Gene Nameaconitase 2, mitochondrial
SynonymsAco-2, Aco3, D10Wsu183e
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81872309-81915133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81913251 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 636 (V636A)
Ref Sequence ENSEMBL: ENSMUSP00000023116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023113] [ENSMUST00000023116] [ENSMUST00000230050]
Predicted Effect probably benign
Transcript: ENSMUST00000023113
SMART Domains Protein: ENSMUSP00000023113
Gene: ENSMUSG00000022476

DomainStartEndE-ValueType
Pfam:SHS2_Rpb7-N 8 77 7.1e-23 PFAM
Pfam:RNA_pol_Rbc25 79 201 2.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023116
AA Change: V636A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477
AA Change: V636A

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229402
Predicted Effect probably benign
Transcript: ENSMUST00000230050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Ms4a3 A T 19: 11,639,218 V20D possibly damaging Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Aco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Aco2 APN 15 81913714 missense possibly damaging 0.88
IGL02450:Aco2 APN 15 81914762 makesense probably null
IGL03408:Aco2 APN 15 81899223 critical splice donor site probably null
ANU22:Aco2 UTSW 15 81913714 missense possibly damaging 0.88
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0254:Aco2 UTSW 15 81889356 missense probably damaging 0.99
R0408:Aco2 UTSW 15 81913118 unclassified probably null
R0535:Aco2 UTSW 15 81913217 missense possibly damaging 0.76
R0839:Aco2 UTSW 15 81907535 splice site probably null
R1199:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1201:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1320:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1321:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1322:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R2082:Aco2 UTSW 15 81913695 missense possibly damaging 0.83
R2275:Aco2 UTSW 15 81895264 missense probably benign 0.37
R2297:Aco2 UTSW 15 81903908 missense probably damaging 1.00
R4414:Aco2 UTSW 15 81889383 splice site probably null
R4497:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4498:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4708:Aco2 UTSW 15 81909916 critical splice donor site probably null
R5556:Aco2 UTSW 15 81889319 missense probably damaging 1.00
R5568:Aco2 UTSW 15 81903586 missense probably damaging 0.99
R6912:Aco2 UTSW 15 81895396 missense probably benign
R7319:Aco2 UTSW 15 81903619 missense probably damaging 1.00
R7552:Aco2 UTSW 15 81903941 missense probably damaging 1.00
R7585:Aco2 UTSW 15 81872484 unclassified probably benign
Z1177:Aco2 UTSW 15 81895310 missense probably damaging 1.00
Z1177:Aco2 UTSW 15 81895312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCCAAGGCTGGTTATATCCC -3'
(R):5'- ACCAAGTATTAAGGGACTAAGCCC -3'

Sequencing Primer
(F):5'- GTCCAAGGCTGGTTATATCCCTAATC -3'
(R):5'- GCCCAGTCTGGAACTCACTGTATAG -3'
Posted On2017-08-16