Incidental Mutation 'R6103:Ift140'
ID 485401
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission 044253-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6103 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25235056-25318461 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25312100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1314 (C1314S)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
AlphaFold E9PY46
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: C1314S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: C1314S

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,768,445 (GRCm39) S926P possibly damaging Het
Acacb T A 5: 114,383,942 (GRCm39) M2157K probably damaging Het
Aco2 T C 15: 81,797,452 (GRCm39) V636A probably benign Het
Adgrf3 T C 5: 30,401,265 (GRCm39) Y51C probably damaging Het
Adprhl1 T C 8: 13,272,055 (GRCm39) T1568A possibly damaging Het
Ank1 T A 8: 23,603,999 (GRCm39) S937T probably damaging Het
Ankrd50 T C 3: 38,508,578 (GRCm39) E340G probably damaging Het
Avpr1b C T 1: 131,537,155 (GRCm39) P90S probably damaging Het
Cacna2d3 T C 14: 29,118,446 (GRCm39) H159R probably damaging Het
Carmil3 A T 14: 55,742,884 (GRCm39) T1185S probably benign Het
Casp2 A T 6: 42,256,814 (GRCm39) R357S probably damaging Het
Ccdc34 A G 2: 109,848,352 (GRCm39) D47G probably benign Het
Cd109 A G 9: 78,605,596 (GRCm39) probably null Het
Cd209d T C 8: 3,928,304 (GRCm39) Y27C probably damaging Het
Cep350 T A 1: 155,800,322 (GRCm39) D1176V probably benign Het
Cpd A T 11: 76,690,625 (GRCm39) S844T probably benign Het
Cyp4x1 A G 4: 114,968,864 (GRCm39) L380P probably damaging Het
Dscam A G 16: 96,626,781 (GRCm39) V376A probably benign Het
Enam T A 5: 88,650,187 (GRCm39) N565K probably damaging Het
Fam110c G A 12: 31,124,794 (GRCm39) W252* probably null Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Fgb T C 3: 82,951,170 (GRCm39) D281G probably benign Het
Frem2 T A 3: 53,457,209 (GRCm39) T2048S probably benign Het
Fut8 A T 12: 77,378,721 (GRCm39) probably benign Het
Glmp T C 3: 88,235,338 (GRCm39) S238P probably benign Het
Gm35315 T A 5: 110,226,137 (GRCm39) Y434F probably damaging Het
Gnpnat1 A G 14: 45,620,856 (GRCm39) F71S probably damaging Het
Gpnmb A G 6: 49,019,820 (GRCm39) R64G possibly damaging Het
Grxcr1 T C 5: 68,323,547 (GRCm39) F275S possibly damaging Het
Kif9 T C 9: 110,318,917 (GRCm39) I127T possibly damaging Het
Mmd2 A G 5: 142,553,618 (GRCm39) probably null Het
Ms4a3 A T 19: 11,616,582 (GRCm39) V20D possibly damaging Het
Mtres1 A T 10: 43,408,916 (GRCm39) Y76N probably benign Het
Myh7b A G 2: 155,460,663 (GRCm39) E272G probably damaging Het
Naaladl1 G A 19: 6,158,743 (GRCm39) G292S probably damaging Het
Notch2 T A 3: 98,043,059 (GRCm39) Y1475N possibly damaging Het
Obp2a G A 2: 25,590,163 (GRCm39) E21K probably damaging Het
Or5ar1 A G 2: 85,671,776 (GRCm39) Y120H probably damaging Het
Osbpl10 T A 9: 114,890,940 (GRCm39) Y109* probably null Het
Plcd1 A T 9: 118,901,109 (GRCm39) W749R probably benign Het
Ptpro A G 6: 137,377,704 (GRCm39) E718G possibly damaging Het
Rbm4 C T 19: 4,837,947 (GRCm39) R295H probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Setdb2 T C 14: 59,646,981 (GRCm39) probably null Het
Slc25a18 C A 6: 120,766,399 (GRCm39) L131I probably damaging Het
Slc4a10 A G 2: 62,064,809 (GRCm39) H221R probably damaging Het
Tbc1d32 A T 10: 56,026,979 (GRCm39) W757R probably damaging Het
Tmem183a C A 1: 134,275,884 (GRCm39) V331L probably benign Het
Try10 C A 6: 41,333,484 (GRCm39) H76Q probably damaging Het
Ttn T A 2: 76,748,599 (GRCm39) H4150L probably benign Het
Vmn2r52 G A 7: 9,905,327 (GRCm39) P171S probably benign Het
Vmn2r88 A G 14: 51,652,826 (GRCm39) T450A probably benign Het
Yipf7 A T 5: 69,698,405 (GRCm39) V34D probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zg16 A G 7: 126,649,748 (GRCm39) V71A probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25,274,618 (GRCm39) missense probably damaging 1.00
IGL00966:Ift140 APN 17 25,237,776 (GRCm39) missense probably damaging 1.00
IGL01082:Ift140 APN 17 25,267,429 (GRCm39) missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25,313,676 (GRCm39) missense probably benign 0.02
IGL01816:Ift140 APN 17 25,305,999 (GRCm39) splice site probably null
IGL01994:Ift140 APN 17 25,267,417 (GRCm39) missense probably damaging 1.00
IGL02102:Ift140 APN 17 25,252,104 (GRCm39) missense probably benign 0.03
IGL02207:Ift140 APN 17 25,274,572 (GRCm39) missense probably benign
IGL02493:Ift140 APN 17 25,306,898 (GRCm39) nonsense probably null
IGL02735:Ift140 APN 17 25,253,009 (GRCm39) splice site probably benign
IGL02902:Ift140 APN 17 25,309,736 (GRCm39) missense probably damaging 1.00
IGL03037:Ift140 APN 17 25,311,368 (GRCm39) missense probably benign 0.02
IGL03122:Ift140 APN 17 25,305,884 (GRCm39) missense probably damaging 1.00
IGL03206:Ift140 APN 17 25,311,800 (GRCm39) missense probably damaging 0.98
IGL03271:Ift140 APN 17 25,306,880 (GRCm39) missense probably damaging 1.00
IGL03358:Ift140 APN 17 25,306,958 (GRCm39) missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25,305,834 (GRCm39) missense probably damaging 0.98
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0197:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0355:Ift140 UTSW 17 25,267,409 (GRCm39) nonsense probably null
R0399:Ift140 UTSW 17 25,269,314 (GRCm39) missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25,270,734 (GRCm39) splice site probably null
R0610:Ift140 UTSW 17 25,254,777 (GRCm39) missense probably benign 0.06
R0701:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0883:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0900:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R1167:Ift140 UTSW 17 25,254,719 (GRCm39) missense probably benign 0.01
R1295:Ift140 UTSW 17 25,307,907 (GRCm39) critical splice donor site probably null
R1588:Ift140 UTSW 17 25,306,959 (GRCm39) missense probably damaging 1.00
R1619:Ift140 UTSW 17 25,307,839 (GRCm39) missense probably damaging 1.00
R1637:Ift140 UTSW 17 25,244,608 (GRCm39) missense probably benign 0.40
R1854:Ift140 UTSW 17 25,254,813 (GRCm39) missense probably benign 0.05
R2397:Ift140 UTSW 17 25,239,710 (GRCm39) missense probably damaging 1.00
R2510:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R2918:Ift140 UTSW 17 25,254,805 (GRCm39) missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R3878:Ift140 UTSW 17 25,247,918 (GRCm39) missense probably benign 0.25
R4559:Ift140 UTSW 17 25,309,741 (GRCm39) missense probably damaging 0.97
R4670:Ift140 UTSW 17 25,317,935 (GRCm39) unclassified probably benign
R4711:Ift140 UTSW 17 25,313,691 (GRCm39) splice site probably null
R4934:Ift140 UTSW 17 25,267,462 (GRCm39) missense probably benign
R4949:Ift140 UTSW 17 25,313,639 (GRCm39) missense probably benign 0.06
R4982:Ift140 UTSW 17 25,255,968 (GRCm39) missense probably damaging 0.99
R5099:Ift140 UTSW 17 25,309,674 (GRCm39) missense probably damaging 1.00
R5223:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R5268:Ift140 UTSW 17 25,239,601 (GRCm39) missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25,252,059 (GRCm39) missense probably damaging 0.96
R5480:Ift140 UTSW 17 25,239,550 (GRCm39) missense probably damaging 1.00
R5655:Ift140 UTSW 17 25,264,038 (GRCm39) missense probably damaging 1.00
R5756:Ift140 UTSW 17 25,247,787 (GRCm39) missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25,308,514 (GRCm39) missense probably damaging 1.00
R5894:Ift140 UTSW 17 25,252,893 (GRCm39) missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25,311,345 (GRCm39) missense probably benign 0.02
R5966:Ift140 UTSW 17 25,313,735 (GRCm39) nonsense probably null
R6000:Ift140 UTSW 17 25,255,934 (GRCm39) missense probably benign 0.00
R6046:Ift140 UTSW 17 25,274,563 (GRCm39) missense probably benign 0.00
R6050:Ift140 UTSW 17 25,309,979 (GRCm39) missense probably damaging 1.00
R6239:Ift140 UTSW 17 25,247,946 (GRCm39) missense probably benign 0.26
R6287:Ift140 UTSW 17 25,269,408 (GRCm39) missense probably benign
R6539:Ift140 UTSW 17 25,313,643 (GRCm39) missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25,251,147 (GRCm39) missense probably damaging 0.96
R6723:Ift140 UTSW 17 25,252,090 (GRCm39) missense probably benign 0.08
R6749:Ift140 UTSW 17 25,317,890 (GRCm39) missense probably damaging 0.99
R6892:Ift140 UTSW 17 25,239,520 (GRCm39) missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25,274,699 (GRCm39) missense probably damaging 1.00
R7235:Ift140 UTSW 17 25,239,619 (GRCm39) missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25,256,010 (GRCm39) missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25,252,089 (GRCm39) missense probably benign 0.02
R7560:Ift140 UTSW 17 25,311,315 (GRCm39) missense probably benign 0.28
R7660:Ift140 UTSW 17 25,270,798 (GRCm39) missense probably damaging 1.00
R8105:Ift140 UTSW 17 25,255,949 (GRCm39) missense probably benign 0.01
R8415:Ift140 UTSW 17 25,311,889 (GRCm39) missense probably damaging 0.99
R8437:Ift140 UTSW 17 25,313,651 (GRCm39) missense probably damaging 0.99
R8747:Ift140 UTSW 17 25,254,809 (GRCm39) missense probably benign
R8932:Ift140 UTSW 17 25,305,862 (GRCm39) missense probably benign 0.03
R9226:Ift140 UTSW 17 25,317,839 (GRCm39) missense probably benign 0.00
R9347:Ift140 UTSW 17 25,313,753 (GRCm39) missense probably benign 0.00
R9451:Ift140 UTSW 17 25,252,925 (GRCm39) missense probably benign 0.33
R9456:Ift140 UTSW 17 25,254,758 (GRCm39) missense probably benign 0.03
R9782:Ift140 UTSW 17 25,264,151 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCTATGATGCCTGTGC -3'
(R):5'- AGAGTCAGCCTGAACTCTGCAG -3'

Sequencing Primer
(F):5'- GACCTGCTTCAGTGTTCTAG -3'
(R):5'- CCTGAACTCTGCAGGGGAGTAG -3'
Posted On 2017-08-16