Incidental Mutation 'R6103:Ms4a3'
ID485404
Institutional Source Beutler Lab
Gene Symbol Ms4a3
Ensembl Gene ENSMUSG00000024681
Gene Namemembrane-spanning 4-domains, subfamily A, member 3
Synonymshaematopoietic cell-specific transmembrane-4, HTm4
MMRRC Submission 044253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6103 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11629496-11640851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11639218 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 20 (V20D)
Ref Sequence ENSEMBL: ENSMUSP00000140508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112984] [ENSMUST00000186023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112984
AA Change: V20D

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108608
Gene: ENSMUSG00000024681
AA Change: V20D

DomainStartEndE-ValueType
Pfam:CD20 27 172 2.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186023
AA Change: V20D

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140508
Gene: ENSMUSG00000024681
AA Change: V20D

DomainStartEndE-ValueType
Pfam:CD20 27 172 9.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190642
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Summary:This gene encodes a member of the membrane-spanning-four (MS4) protein group, that contain a four-transmembrane protein structure. This gene is expressed in developing hematopoietic cells and has also been observed in some regions of the adult brain. Expression of the human ortholog of this gene has also been observed in some human cancer cell lines. This protein may play a role in cell cycle regulation, and interactions have been demonstrated between Ms4a3 and KAP phosphatase. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A T 10: 43,532,920 Y76N probably benign Het
Abcc8 A G 7: 46,119,021 S926P possibly damaging Het
Acacb T A 5: 114,245,881 M2157K probably damaging Het
Aco2 T C 15: 81,913,251 V636A probably benign Het
Adgrf3 T C 5: 30,196,267 Y51C probably damaging Het
Adprhl1 T C 8: 13,222,055 T1568A possibly damaging Het
Ank1 T A 8: 23,113,983 S937T probably damaging Het
Ankrd50 T C 3: 38,454,429 E340G probably damaging Het
Avpr1b C T 1: 131,609,417 P90S probably damaging Het
Cacna2d3 T C 14: 29,396,489 H159R probably damaging Het
Carmil3 A T 14: 55,505,427 T1185S probably benign Het
Casp2 A T 6: 42,279,880 R357S probably damaging Het
Ccdc34 A G 2: 110,018,007 D47G probably benign Het
Cd109 A G 9: 78,698,314 probably null Het
Cd209d T C 8: 3,878,304 Y27C probably damaging Het
Cep350 T A 1: 155,924,576 D1176V probably benign Het
Cpd A T 11: 76,799,799 S844T probably benign Het
Cyp4x1 A G 4: 115,111,667 L380P probably damaging Het
Dscam A G 16: 96,825,581 V376A probably benign Het
Enam T A 5: 88,502,328 N565K probably damaging Het
Fam110c G A 12: 31,074,795 W252* probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fgb T C 3: 83,043,863 D281G probably benign Het
Frem2 T A 3: 53,549,788 T2048S probably benign Het
Fut8 A T 12: 77,331,947 probably benign Het
Glmp T C 3: 88,328,031 S238P probably benign Het
Gm35315 T A 5: 110,078,271 Y434F probably damaging Het
Gnpnat1 A G 14: 45,383,399 F71S probably damaging Het
Gpnmb A G 6: 49,042,886 R64G possibly damaging Het
Grxcr1 T C 5: 68,166,204 F275S possibly damaging Het
Ift140 T A 17: 25,093,126 C1314S probably damaging Het
Kif9 T C 9: 110,489,849 I127T possibly damaging Het
Mmd2 A G 5: 142,567,863 probably null Het
Myh7b A G 2: 155,618,743 E272G probably damaging Het
Naaladl1 G A 19: 6,108,713 G292S probably damaging Het
Notch2 T A 3: 98,135,743 Y1475N possibly damaging Het
Obp2a G A 2: 25,700,151 E21K probably damaging Het
Olfr1019 A G 2: 85,841,432 Y120H probably damaging Het
Osbpl10 T A 9: 115,061,872 Y109* probably null Het
Plcd1 A T 9: 119,072,041 W749R probably benign Het
Ptpro A G 6: 137,400,706 E718G possibly damaging Het
Rbm4 C T 19: 4,787,919 R295H probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setdb2 T C 14: 59,409,532 probably null Het
Slc25a18 C A 6: 120,789,438 L131I probably damaging Het
Slc4a10 A G 2: 62,234,465 H221R probably damaging Het
Tbc1d32 A T 10: 56,150,883 W757R probably damaging Het
Tmem183a C A 1: 134,348,146 V331L probably benign Het
Try10 C A 6: 41,356,550 H76Q probably damaging Het
Ttn T A 2: 76,918,255 H4150L probably benign Het
Vmn2r52 G A 7: 10,171,400 P171S probably benign Het
Vmn2r88 A G 14: 51,415,369 T450A probably benign Het
Yipf7 A T 5: 69,541,062 V34D probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zg16 A G 7: 127,050,576 V71A probably benign Het
Other mutations in Ms4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Ms4a3 APN 19 11629655 utr 3 prime probably benign
IGL01370:Ms4a3 APN 19 11632881 missense probably benign 0.01
IGL01901:Ms4a3 APN 19 11639266 missense possibly damaging 0.86
IGL01950:Ms4a3 APN 19 11632835 missense probably damaging 1.00
R0609:Ms4a3 UTSW 19 11631361 missense possibly damaging 0.79
R1546:Ms4a3 UTSW 19 11632907 missense probably benign 0.10
R1938:Ms4a3 UTSW 19 11635840 missense possibly damaging 0.94
R2367:Ms4a3 UTSW 19 11629744 missense probably benign 0.22
R3890:Ms4a3 UTSW 19 11632907 missense probably benign 0.10
R4727:Ms4a3 UTSW 19 11631378 missense probably damaging 0.97
R6908:Ms4a3 UTSW 19 11638295 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTCTGAGGTACGCTGGGG -3'
(R):5'- CAAGCCTGTGAGTTCTTCCC -3'

Sequencing Primer
(F):5'- CCCTATGAGAGACTGACTGATTC -3'
(R):5'- GTGAGTTCTTCCCCATGATAGC -3'
Posted On2017-08-16