Mutagenetix > Incidental Mutation

Incidental Mutation 'R6104:Chd6'

485411

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

044254-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.687) question?

Stock #

R6104 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 161014132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 736 (T736A)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: T736A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: T736A

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134178
AA Change: T735A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: T735A

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138078

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	T	A	2: 85,508,349	K149*	probably null	Het
Acot11	A	T	4: 106,755,897	L327Q	probably damaging	Het
Atrip	C	T	9: 109,065,564	A432T	possibly damaging	Het
BC005561	T	A	5: 104,518,218	I202K	probably damaging	Het
Cyp1b1	T	A	17: 79,710,205	Y507F	probably damaging	Het
Desi2	G	A	1: 178,249,452	R174H	probably benign	Het
Dopey1	A	T	9: 86,520,807	K1351N	possibly damaging	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Fzd2	T	C	11: 102,606,335	I535T	probably damaging	Het
Gpr15	A	G	16: 58,717,976	F250S	probably damaging	Het
Grm6	T	A	11: 50,859,317	I466N	possibly damaging	Het
Il17a	A	G	1: 20,732,274	Y69C	probably damaging	Het
Itgam	A	G	7: 128,116,302	D938G	possibly damaging	Het
Kmt2c	T	C	5: 25,299,129	D316G	probably benign	Het
Lrba	C	A	3: 86,353,792	A1485E	probably damaging	Het
Marf1	G	A	16: 14,117,455	T1483I	probably damaging	Het
Myo18b	T	C	5: 112,874,291		probably benign	Het
Myo5b	T	A	18: 74,700,679	I842N	probably benign	Het
Nckap5l	C	T	15: 99,423,988	S1092N	probably benign	Het
Nelfcd	T	C	2: 174,423,457	S273P	probably damaging	Het
Nt5c1b	A	G	12: 10,372,955	N83D	probably damaging	Het
Oas3	T	A	5: 120,761,693	I709F	unknown	Het
Olfr1104	T	C	2: 87,021,713	Y277C	probably damaging	Het
Olfr59	C	A	11: 74,289,366	T240N	probably damaging	Het
Pogz	A	G	3: 94,880,031	D1310G	probably benign	Het
Ppfia1	A	G	7: 144,491,574	S949P	possibly damaging	Het
Pxylp1	A	C	9: 96,824,747	F461V	possibly damaging	Het
Rcn3	A	G	7: 45,091,523	Y54H	probably damaging	Het
Rnpepl1	A	G	1: 92,915,884	H242R	probably benign	Het
Rps6ka5	A	T	12: 100,553,148	D735E	possibly damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	G	A	13: 11,799,825	T687M	probably damaging	Het
Scn11a	A	G	9: 119,795,678	I526T	probably damaging	Het
Slc29a3	A	G	10: 60,721,002	V211A	possibly damaging	Het
Syt10	A	T	15: 89,826,864	H155Q	probably benign	Het
Taar8b	A	T	10: 24,092,237	S20T	probably damaging	Het
Tenm4	A	T	7: 96,837,289	I988F	probably damaging	Het
Tlr3	A	G	8: 45,403,093	S17P	probably benign	Het
Tmem87a	A	G	2: 120,394,424	S119P	probably benign	Het
Topaz1	A	G	9: 122,749,866	T614A	probably benign	Het
Vmn2r80	A	C	10: 79,149,020	N69H	probably benign	Het
Xylb	T	A	9: 119,364,507	*66R	probably null	Het
Ylpm1	G	A	12: 85,029,630	R1043H	probably benign	Het
Ythdf3	G	A	3: 16,205,161	V491I	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCATCAACCTCTCTGAAGC -3'
(R):5'- TCCTAAAACCAATGATGCTTCGG -3'

Sequencing Primer
(F):5'- AACCTCTCTGAAGCTCTGTTCTATAC -3'
(R):5'- CTTCGGCGCCTGAAAGATGATG -3'

Posted On

2017-08-16