Incidental Mutation 'R6104:BC005561'
ID485420
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission 044254-MU
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R6104 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104518218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 202 (I202K)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: I202K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: I202K

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Cyp1b1 T A 17: 79,710,205 Y507F probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo18b T C 5: 112,874,291 probably benign Het
Myo5b T A 18: 74,700,679 I842N probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Olfr59 C A 11: 74,289,366 T240N probably damaging Het
Pogz A G 3: 94,880,031 D1310G probably benign Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACATTGGGGTCATTGGGCC -3'
(R):5'- ATGGGGTCTCACCATTTGGC -3'

Sequencing Primer
(F):5'- GGTCATTGGGCCTTATCAAAC -3'
(R):5'- ACCATTTGGCTCCTGGTAAAAC -3'
Posted On2017-08-16