Incidental Mutation 'R6104:Myo18b'
ID485421
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 044254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6104 (G1)
Quality Score179.009
Status Not validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 112874291 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect unknown
Transcript: ENSMUST00000086617
AA Change: T412A
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720
AA Change: T412A

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Predicted Effect probably benign
Transcript: ENSMUST00000183273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
BC005561 T A 5: 104,518,218 I202K probably damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Cyp1b1 T A 17: 79,710,205 Y507F probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo5b T A 18: 74,700,679 I842N probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Olfr59 C A 11: 74,289,366 T240N probably damaging Het
Pogz A G 3: 94,880,031 D1310G probably benign Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
klippel UTSW 5 112757453 critical splice donor site probably null
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7260:Myo18b UTSW 5 112775288 missense probably benign 0.01
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
R7409:Myo18b UTSW 5 112874105 missense probably benign 0.25
R7466:Myo18b UTSW 5 112723892 missense probably benign 0.02
R7487:Myo18b UTSW 5 112834433 missense possibly damaging 0.93
R7571:Myo18b UTSW 5 112830328 missense probably damaging 1.00
R7600:Myo18b UTSW 5 112878103 missense unknown
R7612:Myo18b UTSW 5 112865302 missense possibly damaging 0.82
R7617:Myo18b UTSW 5 112757453 critical splice donor site probably null
R7696:Myo18b UTSW 5 112692292 missense probably damaging 1.00
R7710:Myo18b UTSW 5 112875025 missense unknown
R8047:Myo18b UTSW 5 112723815 missense possibly damaging 0.91
R8070:Myo18b UTSW 5 112791120 missense probably benign 0.01
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Z1176:Myo18b UTSW 5 112762721 missense not run
Z1176:Myo18b UTSW 5 112809738 missense possibly damaging 0.87
Z1176:Myo18b UTSW 5 112831190 missense probably damaging 1.00
Z1177:Myo18b UTSW 5 112692899 missense probably damaging 1.00
Z1177:Myo18b UTSW 5 112762721 missense not run
Z1177:Myo18b UTSW 5 112873541 nonsense probably null
Z1177:Myo18b UTSW 5 112875152 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGATATCCCCGTTGTAGG -3'
(R):5'- ATGAGAAGACCGGCGACTTG -3'

Sequencing Primer
(F):5'- CCGTTGTAGGAATCCTATCCGG -3'
(R):5'- TTGCAAAGCCCAGCGGTAG -3'
Posted On2017-08-16