Incidental Mutation 'R6104:Myo5b'
ID485450
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 044254-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6104 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74700679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 842 (I842N)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: I842N

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: I842N

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: I842N

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: I842N

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
BC005561 T A 5: 104,518,218 I202K probably damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Cyp1b1 T A 17: 79,710,205 Y507F probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo18b T C 5: 112,874,291 probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Olfr59 C A 11: 74,289,366 T240N probably damaging Het
Pogz A G 3: 94,880,031 D1310G probably benign Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 splice site probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
R8383:Myo5b UTSW 18 74643978 missense probably benign 0.05
R8384:Myo5b UTSW 18 74742202 missense probably damaging 1.00
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCACTCTGTGACTAGCTCAATAG -3'
(R):5'- GGAGAGTGGCTGACAAACTC -3'

Sequencing Primer
(F):5'- ATAGATGAGCTCCCTTCCCCTGAG -3'
(R):5'- CTGCAGATCAGGATGTAGAACTCTC -3'
Posted On2017-08-16