Incidental Mutation 'R6105:Vps18'
ID485454
Institutional Source Beutler Lab
Gene Symbol Vps18
Ensembl Gene ENSMUSG00000034216
Gene NameVPS18 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6105 (G1)
Quality Score150.008
Status Not validated
Chromosome2
Chromosomal Location119288740-119298453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119289062 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 8 (Y8C)
Ref Sequence ENSEMBL: ENSMUSP00000036915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037280]
Predicted Effect probably damaging
Transcript: ENSMUST00000037280
AA Change: Y8C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: Y8C

DomainStartEndE-ValueType
Pfam:Pep3_Vps18 291 435 2.4e-41 PFAM
low complexity region 486 500 N/A INTRINSIC
Pfam:Clathrin 619 771 5.9e-11 PFAM
coiled coil region 803 845 N/A INTRINSIC
Blast:RING 853 947 3e-47 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151500
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp111 T C 7: 24,203,366 probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Vps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Vps18 APN 2 119297191 missense probably benign 0.03
IGL02311:Vps18 APN 2 119290251 missense probably benign 0.05
IGL02332:Vps18 APN 2 119293810 missense probably benign 0.04
IGL03089:Vps18 APN 2 119293177 missense probably benign 0.01
IGL03114:Vps18 APN 2 119293651 missense possibly damaging 0.55
IGL03334:Vps18 APN 2 119297482 missense probably damaging 1.00
F5770:Vps18 UTSW 2 119297228 missense probably benign 0.22
R0311:Vps18 UTSW 2 119297365 missense probably benign 0.05
R0346:Vps18 UTSW 2 119297164 missense probably damaging 1.00
R0373:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R0637:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R1493:Vps18 UTSW 2 119297132 missense probably damaging 1.00
R1703:Vps18 UTSW 2 119289057 missense probably benign 0.03
R1734:Vps18 UTSW 2 119293942 missense probably benign 0.01
R4297:Vps18 UTSW 2 119297331 nonsense probably null
R4633:Vps18 UTSW 2 119293276 missense probably damaging 1.00
R4729:Vps18 UTSW 2 119293791 missense probably damaging 1.00
R5034:Vps18 UTSW 2 119293306 missense probably benign 0.00
R5162:Vps18 UTSW 2 119292942 missense probably benign 0.19
R5320:Vps18 UTSW 2 119297377 nonsense probably null
R5857:Vps18 UTSW 2 119297533 missense probably damaging 1.00
R6150:Vps18 UTSW 2 119297592 nonsense probably null
R8018:Vps18 UTSW 2 119294011 missense probably damaging 1.00
RF002:Vps18 UTSW 2 119297390 missense probably damaging 1.00
V7583:Vps18 UTSW 2 119297228 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CGTCCTTCACAGAGAAAGCG -3'
(R):5'- TGTGGCTCTTTCAAACTTCGAC -3'

Sequencing Primer
(F):5'- CGTCCTTCACAGAGAAAGCGAAAAG -3'
(R):5'- CTTCGACCAATGACAAGCTGGG -3'
Posted On2017-08-16