Incidental Mutation 'R6105:Zfp111'
ID485467
Institutional Source Beutler Lab
Gene Symbol Zfp111
Ensembl Gene ENSMUSG00000087598
Gene Namezinc finger protein 111
Synonyms
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6105 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24193947-24211443 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 24203366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056683] [ENSMUST00000073833] [ENSMUST00000073833] [ENSMUST00000086006]
Predicted Effect probably null
Transcript: ENSMUST00000056683
SMART Domains Protein: ENSMUSP00000129484
Gene: ENSMUSG00000087598

DomainStartEndE-ValueType
KRAB 9 64 1.8e-21 SMART
low complexity region 114 128 N/A INTRINSIC
ZnF_C2H2 210 232 2.3e-7 SMART
ZnF_C2H2 266 288 5.7e-4 SMART
ZnF_C2H2 294 316 3.3e-4 SMART
ZnF_C2H2 322 343 4.3e-1 SMART
ZnF_C2H2 349 371 4.5e-8 SMART
ZnF_C2H2 377 399 2.1e-6 SMART
ZnF_C2H2 405 427 8e-6 SMART
ZnF_C2H2 433 455 9.9e-5 SMART
ZnF_C2H2 461 481 4.3e-2 SMART
ZnF_C2H2 489 511 2.7e-5 SMART
ZnF_C2H2 517 539 1.1e-6 SMART
ZnF_C2H2 545 567 1.8e-5 SMART
ZnF_C2H2 573 595 3.5e-6 SMART
ZnF_C2H2 601 623 2.9e-6 SMART
ZnF_C2H2 629 651 1.3e-6 SMART
ZnF_C2H2 657 679 2.2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073833
SMART Domains Protein: ENSMUSP00000083174
Gene: ENSMUSG00000087598

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073833
SMART Domains Protein: ENSMUSP00000083174
Gene: ENSMUSG00000087598

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000086006
SMART Domains Protein: ENSMUSP00000083169
Gene: ENSMUSG00000087598

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160563
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Vps18 A G 2: 119,289,062 Y8C probably damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Zfp111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02569:Zfp111 APN 7 24207069 missense possibly damaging 0.91
IGL02619:Zfp111 APN 7 24199688 missense possibly damaging 0.75
FR4737:Zfp111 UTSW 7 24199805 small insertion probably benign
FR4976:Zfp111 UTSW 7 24199037 missense probably damaging 0.97
FR4976:Zfp111 UTSW 7 24199807 small insertion probably benign
R0514:Zfp111 UTSW 7 24199143 missense probably damaging 0.96
R3837:Zfp111 UTSW 7 24199466 missense possibly damaging 0.53
R4682:Zfp111 UTSW 7 24199138 missense probably damaging 0.98
R4844:Zfp111 UTSW 7 24199376 missense probably damaging 0.99
R6175:Zfp111 UTSW 7 24198129 missense unknown
R7276:Zfp111 UTSW 7 24199553 missense probably damaging 1.00
R7584:Zfp111 UTSW 7 24198600 missense possibly damaging 0.89
X0018:Zfp111 UTSW 7 24199991 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGTGGCATTGACTAAGACATAGC -3'
(R):5'- CATTGGGAATGAATCTGAGGTG -3'

Sequencing Primer
(F):5'- TGGTGGCTCACAACCATCTGTAAG -3'
(R):5'- AATGAATCTGAGGTGGCATGTGC -3'
Posted On2017-08-16