Incidental Mutation 'R6105:Kxd1'
ID485473
Institutional Source Beutler Lab
Gene Symbol Kxd1
Ensembl Gene ENSMUSG00000055553
Gene NameKxDL motif containing 1
Synonyms
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6105 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70508272-70527956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70519939 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 33 (N33K)
Ref Sequence ENSEMBL: ENSMUSP00000123548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093456] [ENSMUST00000117580] [ENSMUST00000118850] [ENSMUST00000121623] [ENSMUST00000132867] [ENSMUST00000137610] [ENSMUST00000138260] [ENSMUST00000155677]
Predicted Effect probably benign
Transcript: ENSMUST00000093456
AA Change: N33K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091165
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 12 99 1.9e-40 PFAM
low complexity region 115 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117580
AA Change: N33K

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118850
AA Change: N75K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113816
Gene: ENSMUSG00000055553
AA Change: N75K

DomainStartEndE-ValueType
low complexity region 32 40 N/A INTRINSIC
Pfam:KxDL 54 141 1.2e-39 PFAM
low complexity region 157 166 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121623
AA Change: N33K
SMART Domains Protein: ENSMUSP00000113804
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 14 99 3.3e-34 PFAM
UBQ 105 176 2.14e-36 SMART
Ribosomal_L40e 181 232 1.02e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132867
Predicted Effect probably benign
Transcript: ENSMUST00000137610
AA Change: N33K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121539
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 12 99 1.3e-40 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138260
AA Change: N33K
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138586
Predicted Effect probably benign
Transcript: ENSMUST00000155677
AA Change: N33K

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123548
Gene: ENSMUSG00000055553
AA Change: N33K

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced melanosomes in the choroid and retinal pigment epithelium and decreased platelet dense granule number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Vps18 A G 2: 119,289,062 Y8C probably damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp111 T C 7: 24,203,366 probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Kxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Kxd1 APN 8 70515443 critical splice acceptor site probably null
IGL02331:Kxd1 APN 8 70515440 missense probably benign 0.10
IGL03268:Kxd1 APN 8 70508486 missense probably damaging 1.00
R3499:Kxd1 UTSW 8 70513982 splice site probably null
R6101:Kxd1 UTSW 8 70519939 missense probably benign 0.15
R6302:Kxd1 UTSW 8 70520063 critical splice acceptor site probably null
R6925:Kxd1 UTSW 8 70523278 start codon destroyed probably null
R7154:Kxd1 UTSW 8 70515434 missense probably damaging 1.00
R8032:Kxd1 UTSW 8 70514141 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGCCAATGCCAAAAGCTAGC -3'
(R):5'- TGATGAGTTCTTGACATCACCTG -3'

Sequencing Primer
(F):5'- CAGAAGAGCCTCTGAGTATTCCTG -3'
(R):5'- GTCTCGTGCTGACCTCACATTG -3'
Posted On2017-08-16