Incidental Mutation 'R0521:Kcnu1'
ID48548
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 038714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0521 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25910888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 688 (L688R)
Ref Sequence ENSEMBL: ENSMUSP00000096457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858] [ENSMUST00000120653] [ENSMUST00000126226]
Predicted Effect probably damaging
Transcript: ENSMUST00000098858
AA Change: L688R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: L688R

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120653
SMART Domains Protein: ENSMUSP00000113442
Gene: ENSMUSG00000031576

DomainStartEndE-ValueType
PDB:4HPF|B 1 332 1e-144 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126226
SMART Domains Protein: ENSMUSP00000123273
Gene: ENSMUSG00000031576

DomainStartEndE-ValueType
PDB:4HPF|B 1 160 5e-61 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Aadacl3 A T 4: 144,455,894 S335T probably damaging Het
Abcb1b G A 5: 8,864,238 A1203T probably damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Angel1 G A 12: 86,722,907 S193F probably benign Het
Ankrd16 T C 2: 11,789,881 V359A probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Armc4 G A 18: 7,222,676 P531L possibly damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Bpifa5 C A 2: 154,166,949 D223E probably benign Het
C87499 A T 4: 88,629,322 N37K probably damaging Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Ccm2 G A 11: 6,590,886 S184N probably damaging Het
Ces5a T A 8: 93,525,658 D202V probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Cog7 C A 7: 121,941,169 probably null Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Cps1 A C 1: 67,215,564 D1304A probably benign Het
Crhbp C A 13: 95,443,895 probably null Het
Ctdspl2 T A 2: 122,006,887 C377* probably null Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Ddost A G 4: 138,310,735 T262A probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx54 A G 5: 120,626,862 I769V probably benign Het
Dock1 T A 7: 135,143,778 I1463N probably benign Het
Dsg3 T A 18: 20,527,815 Y404N possibly damaging Het
Epb42 T A 2: 121,029,150 K186* probably null Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Farp2 A G 1: 93,576,821 probably null Het
Fev C A 1: 74,882,533 R86L possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Foxn3 A G 12: 99,209,506 V261A probably benign Het
Fsd1 A G 17: 55,991,245 D190G probably benign Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Gsdma2 A T 11: 98,654,901 K260* probably null Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hic1 G A 11: 75,166,887 P392L possibly damaging Het
Hk3 C T 13: 55,014,426 probably null Het
Ifna6 G T 4: 88,827,650 V79F probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kdm5b T A 1: 134,618,033 S977R possibly damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Lrrc29 A T 8: 105,312,793 L617Q probably damaging Het
Map1a T G 2: 121,305,753 L2350R probably damaging Het
Mdfic A G 6: 15,799,756 D212G probably benign Het
Ms4a1 C A 19: 11,258,679 probably null Het
Myo9a T A 9: 59,894,352 F1944L probably damaging Het
Nbea A T 3: 56,008,268 W928R probably damaging Het
Nfatc2ip T G 7: 126,396,579 D46A possibly damaging Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nsd2 T A 5: 33,843,338 N66K probably damaging Het
Nsmce4a T C 7: 130,537,002 H304R probably damaging Het
Olfr1099 C T 2: 86,958,846 G204D probably damaging Het
Olfr1239 T C 2: 89,418,200 Y71C probably damaging Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr859 G A 9: 19,808,860 V181I probably benign Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
R3hdm1 G A 1: 128,193,703 V315I probably benign Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Thnsl2 A T 6: 71,134,259 D208E probably damaging Het
Tie1 A C 4: 118,476,146 I841R probably damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tnfaip8l1 A T 17: 56,171,727 T6S probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Vmn2r9 C A 5: 108,848,288 G165* probably null Het
Xkr6 A T 14: 63,819,422 I261F probably benign Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Yipf1 A G 4: 107,336,190 Y91C probably benign Het
Zfp442 T C 2: 150,411,249 D31G possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zfp804a C T 2: 82,259,417 Q1197* probably null Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7202:Kcnu1 UTSW 8 25919581 splice site probably null
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
R7411:Kcnu1 UTSW 8 25892088 missense probably damaging 1.00
R7520:Kcnu1 UTSW 8 25885340 missense probably damaging 1.00
R7579:Kcnu1 UTSW 8 25896658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCGTATTTCGAGCAAGAGCATC -3'
(R):5'- CAGCATACCGCTACCCAGTCTTTG -3'

Sequencing Primer
(F):5'- ATCCTCTAACCTAAGCCTTAAGTGG -3'
(R):5'- TCATGCCTCGTGGTCGG -3'
Posted On2013-06-12