Incidental Mutation 'R6105:Kif2b'
ID485481
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Namekinesin family member 2B
Synonyms1700063D03Rik
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R6105 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location91575315-91577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91575988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 490 (S490P)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
Predicted Effect probably benign
Transcript: ENSMUST00000061019
AA Change: S490P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: S490P

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Vps18 A G 2: 119,289,062 Y8C probably damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp111 T C 7: 24,203,366 probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATCAGTGGTACCTCATGGC -3'
(R):5'- TCATTCTCAAGGCTGGAGGGAAG -3'

Sequencing Primer
(F):5'- ACACAGTGATGGTAGGGCCTTG -3'
(R):5'- AAGCTGCACGGCAAGTTTTC -3'
Posted On2017-08-16