Mutagenetix > Incidental Mutation

Incidental Mutation 'R6105:Thbs4'

485483

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

044255-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6105 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92775485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 246 (Q246K)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022213
AA Change: Q246K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: Q246K

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168299

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,397,812	M3555T	probably damaging	Het
Adam9	A	T	8: 24,970,759	C570S	probably damaging	Het
Adh6b	T	A	3: 138,357,710	I350K	possibly damaging	Het
Ahnak	G	A	19: 9,004,099	V916I	probably benign	Het
Aldh4a1	C	T	4: 139,638,495	P266S	possibly damaging	Het
Cnot7	C	T	8: 40,510,037	R32Q	probably benign	Het
Cyb5a	G	A	18: 84,871,593	R49Q	possibly damaging	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Glul	T	A	1: 153,906,431	Y137*	probably null	Het
Ipo8	A	G	6: 148,798,670	Y570H	probably damaging	Het
Kif2b	A	G	11: 91,575,988	S490P	probably benign	Het
Kxd1	A	T	8: 70,519,939	N33K	probably benign	Het
Man2a2	T	C	7: 80,367,001	D355G	probably damaging	Het
Map6	T	C	7: 99,268,107	V29A	probably damaging	Het
Mtmr3	T	C	11: 4,485,432	D1116G	probably damaging	Het
Olfr1198	T	A	2: 88,746,840	H16L	probably benign	Het
Olfr917	A	G	9: 38,665,620	S75P	probably damaging	Het
Olfr926	T	C	9: 38,877,308	L44P	possibly damaging	Het
Pak1ip1	T	A	13: 41,004,885	L78Q	probably damaging	Het
Phf10	C	T	17: 14,954,125		probably null	Het
Pikfyve	A	G	1: 65,264,345		probably null	Het
Pkd1l3	A	G	8: 109,640,846	D1225G	probably damaging	Het
Postn	A	G	3: 54,372,220		probably null	Het
Slc22a30	T	C	19: 8,337,868		probably null	Het
Specc1l	T	C	10: 75,248,632	S730P	probably damaging	Het
Steap2	T	A	5: 5,675,891	I378F	possibly damaging	Het
Sult4a1	T	A	15: 84,086,620	K195*	probably null	Het
Tgfb1i1	T	A	7: 128,248,417		probably null	Het
Tnfsf10	A	G	3: 27,335,549	Y253C	probably damaging	Het
Tnpo3	G	T	6: 29,588,043	C125*	probably null	Het
Trappc8	A	G	18: 20,846,447		probably null	Het
Trpm6	C	T	19: 18,853,748	R1326*	probably null	Het
Vmn2r19	A	C	6: 123,316,095	E365D	possibly damaging	Het
Vps18	A	G	2: 119,289,062	Y8C	probably damaging	Het
Zc3hav1l	A	G	6: 38,293,077	V279A	probably benign	Het
Zfp111	T	C	7: 24,203,366		probably null	Het
Zfp618	A	T	4: 63,133,241	Q753L	probably benign	Het
Zkscan17	A	T	11: 59,503,575	C67S	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGGCTCACTACAAGCATG -3'
(R):5'- GCAATTATTTGAGGAGTCAGCTG -3'

Sequencing Primer
(F):5'- GGAGGCTCACTACAAGCATGATCTC -3'
(R):5'- CTATTCCTAGGACTCATGAGGC -3'

Posted On

2017-08-16