Incidental Mutation 'R6106:Nrd1'
ID485501
Institutional Source Beutler Lab
Gene Symbol Nrd1
Ensembl Gene ENSMUSG00000053510
Gene Namenardilysin, N-arginine dibasic convertase, NRD convertase 1
SynonymsNRD-C
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109000655-109061777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109044585 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 617 (K617M)
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]
Predicted Effect probably damaging
Transcript: ENSMUST00000065977
AA Change: K617M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: K617M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102736
AA Change: K573M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: K573M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106644
AA Change: K685M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: K685M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125645
AA Change: K369M

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510
AA Change: K369M

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 100 6.4e-27 PFAM
Pfam:Peptidase_M16_C 125 311 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Nrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrd1 APN 4 109046687 unclassified probably benign
IGL00857:Nrd1 APN 4 109054002 missense probably damaging 1.00
IGL01417:Nrd1 APN 4 109000830 utr 5 prime probably benign
IGL01457:Nrd1 APN 4 109047660 missense probably benign 0.03
IGL02112:Nrd1 APN 4 109027432 splice site probably benign
IGL02279:Nrd1 APN 4 109024194 splice site probably benign
IGL02332:Nrd1 APN 4 109000988 missense probably damaging 0.99
IGL02890:Nrd1 APN 4 109053919 missense possibly damaging 0.55
IGL03179:Nrd1 APN 4 109046691 unclassified probably benign
PIT4354001:Nrd1 UTSW 4 109054025 critical splice donor site probably null
R0551:Nrd1 UTSW 4 109047708 missense probably damaging 1.00
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1990:Nrd1 UTSW 4 109039775 nonsense probably null
R4391:Nrd1 UTSW 4 109046644 missense probably damaging 1.00
R4994:Nrd1 UTSW 4 109046612 missense probably benign
R5164:Nrd1 UTSW 4 109039717 missense probably damaging 0.99
R5229:Nrd1 UTSW 4 109049108 missense probably damaging 1.00
R5387:Nrd1 UTSW 4 109039762 missense probably damaging 1.00
R5530:Nrd1 UTSW 4 109047609 missense probably damaging 0.96
R5672:Nrd1 UTSW 4 109038045 nonsense probably null
R5990:Nrd1 UTSW 4 109019071 missense probably damaging 1.00
R6018:Nrd1 UTSW 4 109013747 missense probably benign 0.01
R6114:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6140:Nrd1 UTSW 4 109049111 missense probably damaging 0.97
R6285:Nrd1 UTSW 4 109038006 missense probably damaging 0.99
R6824:Nrd1 UTSW 4 109043425 missense probably damaging 1.00
R7019:Nrd1 UTSW 4 109028802 missense probably benign 0.33
R7353:Nrd1 UTSW 4 109039749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACATCATGACACTGTAGAAAC -3'
(R):5'- TTTGTCTCCATAAGAACCACCAAAG -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCCAGGACAGCC -3'
(R):5'- TCAGCAGTAGAGAGTTCCTGC -3'
Posted On2017-08-16