Incidental Mutation 'R6106:Fam193a'
ID485503
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Namefamily with sequence similarity 193, member A
Synonyms
MMRRC Submission 044256-MU
Accession Numbers

Ncbi RefSeq: NM_001243123.1; MGI:2447768

Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34369933-34486456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34459030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 564 (T564S)
Ref Sequence ENSEMBL: ENSMUSP00000092463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094867
AA Change: T564S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: T564S

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180376
AA Change: T850S

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: T850S

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201005
AA Change: K107N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34431193 missense probably damaging 0.99
IGL02111:Fam193a APN 5 34410657 missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34444737 missense probably benign 0.12
IGL02218:Fam193a APN 5 34443588 missense possibly damaging 0.68
P0017:Fam193a UTSW 5 34440463 missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34440535 missense probably damaging 0.97
R0172:Fam193a UTSW 5 34465613 missense probably damaging 0.97
R0413:Fam193a UTSW 5 34466208 missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34426391 missense probably damaging 1.00
R0735:Fam193a UTSW 5 34439378 missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34443341 missense probably damaging 0.99
R0904:Fam193a UTSW 5 34462143 missense probably damaging 1.00
R1756:Fam193a UTSW 5 34466292 missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34436497 missense probably damaging 0.99
R1766:Fam193a UTSW 5 34462131 missense probably damaging 0.99
R1845:Fam193a UTSW 5 34443372 missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34462150 missense probably benign 0.19
R2483:Fam193a UTSW 5 34465758 missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34465672 missense probably benign 0.33
R4523:Fam193a UTSW 5 34443371 missense probably benign 0.07
R4723:Fam193a UTSW 5 34420786 missense probably benign 0.04
R4823:Fam193a UTSW 5 34459028 missense probably damaging 1.00
R4826:Fam193a UTSW 5 34436531 missense probably damaging 1.00
R4863:Fam193a UTSW 5 34466205 missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34465571 splice site probably null
R5364:Fam193a UTSW 5 34466253 missense probably benign 0.01
R5564:Fam193a UTSW 5 34420855 missense probably damaging 0.98
R5580:Fam193a UTSW 5 34420788 missense probably benign 0.33
R5784:Fam193a UTSW 5 34466223 missense probably damaging 0.99
R5933:Fam193a UTSW 5 34465680 missense probably damaging 0.98
R5949:Fam193a UTSW 5 34440472 missense possibly damaging 0.82
R6181:Fam193a UTSW 5 34443540 intron probably null
R7095:Fam193a UTSW 5 34458034 missense probably damaging 0.99
R7109:Fam193a UTSW 5 34465821 missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34485730 missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34465635 missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34464116 missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34420788 missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34431182 missense probably damaging 0.99
R7768:Fam193a UTSW 5 34465791 missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34431180 missense probably damaging 0.99
R7818:Fam193a UTSW 5 34465653 missense possibly damaging 0.72
Z1088:Fam193a UTSW 5 34420895 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGATATTCCTGTTCTATGCTTGAAGG -3'
(R):5'- ACTGCTGCTAGACTGCACTG -3'

Sequencing Primer
(F):5'- GTGACCTTAGACAAGTTGCTTAGCC -3'
(R):5'- CTAGACTGCACTGTGGTGGC -3'
Posted On2017-08-16