Incidental Mutation 'R6106:Bfsp2'
ID485516
Institutional Source Beutler Lab
Gene Symbol Bfsp2
Ensembl Gene ENSMUSG00000032556
Gene Namebeaded filament structural protein 2, phakinin
SynonymsCP49
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location103424924-103480420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103479824 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 135 (T135S)
Ref Sequence ENSEMBL: ENSMUSP00000116249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000124310] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect probably benign
Transcript: ENSMUST00000049452
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124310
AA Change: T135S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: T135S

DomainStartEndE-ValueType
Filament 102 416 6.85e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144420
Predicted Effect probably benign
Transcript: ENSMUST00000189066
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Bfsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Bfsp2 APN 9 103453098 missense possibly damaging 0.90
IGL01160:Bfsp2 APN 9 103480168 missense probably benign 0.02
R0408:Bfsp2 UTSW 9 103480100 missense probably benign 0.06
R0463:Bfsp2 UTSW 9 103426655 missense possibly damaging 0.94
R1454:Bfsp2 UTSW 9 103480225 start codon destroyed probably null 0.59
R1854:Bfsp2 UTSW 9 103449831 missense probably benign 0.01
R2139:Bfsp2 UTSW 9 103449875 missense probably benign 0.19
R2187:Bfsp2 UTSW 9 103426777 nonsense probably null
R3975:Bfsp2 UTSW 9 103480072 missense probably benign 0.00
R4823:Bfsp2 UTSW 9 103479883 missense probably damaging 1.00
R5035:Bfsp2 UTSW 9 103479866 missense probably benign 0.35
R5973:Bfsp2 UTSW 9 103432657 critical splice donor site probably null
R6005:Bfsp2 UTSW 9 103448550 missense probably damaging 0.99
R6348:Bfsp2 UTSW 9 103480072 missense probably benign 0.17
R6364:Bfsp2 UTSW 9 103448628 missense probably damaging 0.98
R6701:Bfsp2 UTSW 9 103479878 missense possibly damaging 0.68
R6736:Bfsp2 UTSW 9 103480204 missense possibly damaging 0.60
R7129:Bfsp2 UTSW 9 103479919 missense probably damaging 0.99
R7204:Bfsp2 UTSW 9 103432666 missense probably damaging 0.99
R7329:Bfsp2 UTSW 9 103449922 missense probably benign 0.01
R7453:Bfsp2 UTSW 9 103453107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGCCAGTGTTAACAC -3'
(R):5'- TGGGCATCAGCAGTGTCTTTC -3'

Sequencing Primer
(F):5'- ATGGAAGAGATCTACTTCCCTGGC -3'
(R):5'- CATCAGCAGTGTCTTTCTACAGGG -3'
Posted On2017-08-16