Incidental Mutation 'R6106:Cnot8'
ID485519
Institutional Source Beutler Lab
Gene Symbol Cnot8
Ensembl Gene ENSMUSG00000020515
Gene NameCCR4-NOT transcription complex, subunit 8
Synonyms
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58104153-58118594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58113990 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 172 (S172P)
Ref Sequence ENSEMBL: ENSMUSP00000104471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020822] [ENSMUST00000108843] [ENSMUST00000134896]
Predicted Effect probably damaging
Transcript: ENSMUST00000020822
AA Change: S172P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020822
Gene: ENSMUSG00000020515
AA Change: S172P

DomainStartEndE-ValueType
Pfam:CAF1 15 139 4.3e-15 PFAM
Pfam:CAF1 138 238 1.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108843
AA Change: S172P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104471
Gene: ENSMUSG00000020515
AA Change: S172P

DomainStartEndE-ValueType
Pfam:CAF1 13 240 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133923
Predicted Effect probably benign
Transcript: ENSMUST00000134896
SMART Domains Protein: ENSMUSP00000116116
Gene: ENSMUSG00000020515

DomainStartEndE-ValueType
Pfam:CAF1 13 75 3.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Cnot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Cnot8 APN 11 58111362 missense probably damaging 1.00
IGL01774:Cnot8 APN 11 58115307 missense probably benign 0.01
IGL02877:Cnot8 APN 11 58111402 missense probably benign 0.01
straws UTSW 11 58114065 missense probably damaging 1.00
R0465:Cnot8 UTSW 11 58114060 missense probably damaging 0.99
R1802:Cnot8 UTSW 11 58117535 missense probably benign 0.01
R2418:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R2419:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R5199:Cnot8 UTSW 11 58115274 nonsense probably null
R5257:Cnot8 UTSW 11 58117522 missense possibly damaging 0.94
R5317:Cnot8 UTSW 11 58113203 missense probably damaging 1.00
R5351:Cnot8 UTSW 11 58115321 missense probably damaging 1.00
R5702:Cnot8 UTSW 11 58114047 missense possibly damaging 0.71
R6261:Cnot8 UTSW 11 58114051 missense probably damaging 1.00
R6419:Cnot8 UTSW 11 58114065 missense probably damaging 1.00
R6947:Cnot8 UTSW 11 58117505 missense probably benign 0.03
R7070:Cnot8 UTSW 11 58117452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCTCTTACGGCTTTAC -3'
(R):5'- CAAAACAAGCCTGAGTGTGG -3'

Sequencing Primer
(F):5'- ACAAACTCTCAGGTTCTTGTGTG -3'
(R):5'- CAAGCCTGAGTGTGGGAGTC -3'
Posted On2017-08-16