Mutagenetix > Incidental Mutation

Incidental Mutation 'R6106:Setdb2'

485525

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

044256-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R6106 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 59423449 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 82 (K82*)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably null
Transcript: ENSMUST00000095775
AA Change: K98*

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: K98*

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000111253
AA Change: K82*

Predicted Effect

probably null
Transcript: ENSMUST00000161459
AA Change: K82*

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: K82*

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,613,412	T1105A	possibly damaging	Het
Ace	A	G	11: 105,989,012	E726G	probably damaging	Het
Adgrl4	A	G	3: 151,540,985	I641V	possibly damaging	Het
Apoa5	A	T	9: 46,270,633	R336*	probably null	Het
Bfsp2	T	A	9: 103,479,824	T135S	probably benign	Het
Calhm2	A	T	19: 47,133,062	Y223N	probably damaging	Het
Ccdc158	T	C	5: 92,627,466	E960G	probably benign	Het
Ccdc80	T	C	16: 45,096,710	S610P	probably benign	Het
Cdon	T	A	9: 35,455,408	Y193*	probably null	Het
Cept1	A	T	3: 106,503,676	H400Q	probably benign	Het
Clspn	T	A	4: 126,590,641	N1197K	probably benign	Het
Cnot8	T	C	11: 58,113,990	S172P	probably damaging	Het
Col14a1	T	C	15: 55,520,008	I1794T	probably damaging	Het
Fam183b	T	C	11: 58,796,601	E66G	probably damaging	Het
Fam193a	A	T	5: 34,459,030	T564S	possibly damaging	Het
Galnt1	G	A	18: 24,254,663	V154I	probably benign	Het
Gm14139	A	G	2: 150,192,805	K349E	probably damaging	Het
Gstcd	C	A	3: 132,998,914	E526D	probably benign	Het
Ighv1-42	A	C	12: 114,937,287	S59R	probably benign	Het
Morn3	A	G	5: 123,046,760	C6R	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr169	A	G	16: 19,566,259	L208P	probably damaging	Het
Olfr632	A	G	7: 103,938,193	H271R	probably benign	Het
Olfr883	T	A	9: 38,026,466	I220N	probably damaging	Het
Olfr913	T	C	9: 38,594,956	M245T	probably benign	Het
Pcdhb11	A	G	18: 37,423,003	N462S	probably damaging	Het
Pfpl	G	T	19: 12,429,461	D359Y	probably damaging	Het
Phyhip	T	C	14: 70,461,859	V34A	probably benign	Het
Pigu	A	T	2: 155,297,196	I313N	possibly damaging	Het
Plch1	C	T	3: 63,702,023	R912H	probably damaging	Het
Psg16	T	A	7: 17,095,166	F225Y	possibly damaging	Het
Sgms1	A	G	19: 32,124,425	S394P	possibly damaging	Het
Slc16a1	T	C	3: 104,652,994	L205P	probably benign	Het
Slc19a1	T	A	10: 77,044,769	I380N	probably damaging	Het
Snx32	A	G	19: 5,498,014	I131T	probably benign	Het
Sorbs3	T	C	14: 70,192,604		probably null	Het
Stc2	T	A	11: 31,360,392	I215L	probably benign	Het
Tln2	C	T	9: 67,323,020	A84T	probably damaging	Het
Tomm34	A	G	2: 164,060,991	M133T	probably benign	Het
Usp43	A	G	11: 67,879,907	S634P	probably benign	Het
Vmn2r59	T	A	7: 42,012,325	R689*	probably null	Het
Vmn2r9	C	T	5: 108,845,036	R536Q	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zfhx2	T	A	14: 55,068,310		probably null	Het
Zfp608	G	T	18: 54,987,872	H214Q	possibly damaging	Het
Zfp619	T	C	7: 39,535,134	V196A	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGACACTGAGCTGACACTG -3'
(R):5'- GGCAATCTTATGGCTGAGTCTC -3'

Sequencing Primer
(F):5'- GACACTGGAGGCCATTTTAATATTCC -3'
(R):5'- TGGCTGAGTCTCAAAATTTTAGTATC -3'

Posted On

2017-08-16