Incidental Mutation 'R6106:Sorbs3'
ID485526
Institutional Source Beutler Lab
Gene Symbol Sorbs3
Ensembl Gene ENSMUSG00000022091
Gene Namesorbin and SH3 domain containing 3
SynonymsSH3P3, Sh3d4, vinexin beta, vinexin alpha
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70180468-70211989 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 70192604 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022682] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]
Predicted Effect probably null
Transcript: ENSMUST00000022682
SMART Domains Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091

DomainStartEndE-ValueType
Sorb 165 214 6.87e-30 SMART
SH3 447 502 9.24e-21 SMART
SH3 521 578 4.18e-19 SMART
low complexity region 597 613 N/A INTRINSIC
SH3 677 733 8.31e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227259
Predicted Effect probably null
Transcript: ENSMUST00000227653
Predicted Effect probably null
Transcript: ENSMUST00000227929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Sorbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sorbs3 APN 14 70191155 missense probably damaging 1.00
IGL01144:Sorbs3 APN 14 70191568 missense probably benign 0.04
IGL01155:Sorbs3 APN 14 70199341 missense probably damaging 1.00
IGL01465:Sorbs3 APN 14 70195509 splice site probably benign
IGL02184:Sorbs3 APN 14 70184006 critical splice donor site probably null
R0544:Sorbs3 UTSW 14 70193926 missense probably benign 0.01
R0882:Sorbs3 UTSW 14 70207572 missense probably damaging 1.00
R1445:Sorbs3 UTSW 14 70193646 missense probably benign 0.12
R1493:Sorbs3 UTSW 14 70192627 missense possibly damaging 0.71
R1505:Sorbs3 UTSW 14 70190802 nonsense probably null
R1671:Sorbs3 UTSW 14 70191466 missense possibly damaging 0.92
R2184:Sorbs3 UTSW 14 70191431 critical splice donor site probably null
R3804:Sorbs3 UTSW 14 70199351 splice site probably benign
R4527:Sorbs3 UTSW 14 70207617 missense probably damaging 1.00
R4755:Sorbs3 UTSW 14 70184099 missense probably benign 0.00
R4926:Sorbs3 UTSW 14 70186945 missense probably damaging 1.00
R5257:Sorbs3 UTSW 14 70185034 missense probably benign 0.00
R5304:Sorbs3 UTSW 14 70184896 nonsense probably null
R5328:Sorbs3 UTSW 14 70181174 missense probably damaging 1.00
R5684:Sorbs3 UTSW 14 70181222 missense probably damaging 1.00
R5988:Sorbs3 UTSW 14 70203303 missense probably benign 0.03
R7207:Sorbs3 UTSW 14 70201485 missense probably damaging 1.00
R7562:Sorbs3 UTSW 14 70207527 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCGATACACTGAACCAGAG -3'
(R):5'- CCTTGAACCATGACTACAGGC -3'

Sequencing Primer
(F):5'- AGTTGGCCAGGAAGGGTTCTC -3'
(R):5'- TTGAACCATGACTACAGGCATCAGG -3'
Posted On2017-08-16