Mutagenetix > Incidental Mutations

Incidental Mutation 'R6107:Inpp4a'

485539

Institutional Source

Beutler Lab

Gene Symbol

Inpp4a

Ensembl Gene

ENSMUSG00000026113

Gene Name

inositol polyphosphate-4-phosphatase, type I

Synonyms

107kDa

MMRRC Submission

044257-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.307) question?

Stock #

R6107 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37299865-37410736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37377748 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 450 (I450N)

Ref Sequence

ENSEMBL: ENSMUSP00000121803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027287
AA Change: I451N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: I451N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	1e-57	BLAST
SCOP:d1bdya_	50	168	7e-5	SMART
low complexity region	565	590	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058307
AA Change: I186N

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: I186N

Domain	Start	End	E-Value	Type
transmembrane domain	651	673	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114933
AA Change: I186N

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: I186N

Domain	Start	End	E-Value	Type
low complexity region	300	325	N/A	INTRINSIC
transmembrane domain	662	684	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123124

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132401
AA Change: I445N

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: I445N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	1e-57	BLAST
SCOP:d1bdya_	50	168	6e-5	SMART
low complexity region	602	623	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132615
AA Change: I450N

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: I450N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	1e-57	BLAST
SCOP:d1bdya_	50	168	7e-5	SMART
low complexity region	565	590	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136846
AA Change: I450N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: I450N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	9e-58	BLAST
SCOP:d1bdya_	50	168	7e-5	SMART
low complexity region	559	584	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137266
AA Change: I450N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: I450N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	1e-57	BLAST
SCOP:d1bdya_	50	168	6e-5	SMART
low complexity region	377	391	N/A	INTRINSIC
low complexity region	607	628	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140264
AA Change: I445N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: I445N

Domain	Start	End	E-Value	Type
Blast:C2	49	142	7e-58	BLAST
SCOP:d1bdya_	50	168	7e-5	SMART
low complexity region	377	391	N/A	INTRINSIC
low complexity region	564	589	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168546
AA Change: I186N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: I186N

Domain	Start	End	E-Value	Type
transmembrane domain	651	673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193774

SMART Domains

Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113

Domain	Start	End	E-Value	Type
Blast:C2	45	87	7e-13	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrl3	A	G	5: 81,688,563	R723G	probably damaging	Het
Ankrd52	C	A	10: 128,387,012	N610K	probably benign	Het
Atp2a3	A	G	11: 72,988,461		probably null	Het
Bahcc1	G	A	11: 120,272,888	A671T	probably benign	Het
Col6a5	A	T	9: 105,892,272	Y1764*	probably null	Het
E2f8	A	G	7: 48,867,676	V793A	probably benign	Het
Erbin	A	G	13: 103,833,892	I1072T	probably benign	Het
Exoc2	T	C	13: 30,876,797	I575V	probably benign	Het
Fbxw19	C	T	9: 109,495,766	V28M	probably damaging	Het
Flt1	G	A	5: 147,603,593	T762M	probably benign	Het
Ghitm	C	A	14: 37,125,209	A303S	probably damaging	Het
Gm18856	T	A	13: 13,965,734		probably benign	Het
Gm5493	T	A	17: 22,748,096	H68Q	possibly damaging	Het
Hells	T	G	19: 38,953,649	I461S	probably benign	Het
Kbtbd6	T	A	14: 79,453,113	V353D	probably damaging	Het
Kifap3	A	T	1: 163,868,769	T656S	possibly damaging	Het
Med23	A	T	10: 24,906,034	K713*	probably null	Het
Miga1	A	T	3: 152,335,399	F44I	probably benign	Het
Ngrn	A	G	7: 80,261,877	E74G	probably damaging	Het
Olfr1286	T	C	2: 111,420,655	S99G	probably benign	Het
Patl2	A	T	2: 122,127,486	L97Q	probably damaging	Het
Pcdha1	A	G	18: 36,932,301	I673V	probably benign	Het
Pcsk1	A	G	13: 75,127,848	T543A	probably benign	Het
Plch1	C	T	3: 63,702,023	R912H	probably damaging	Het
Prl8a8	A	G	13: 27,511,464	V100A	possibly damaging	Het
Rnase10	T	A	14: 51,009,294	V43E	possibly damaging	Het
Robo1	A	G	16: 72,983,829	S816G	probably benign	Het
Slc25a34	C	T	4: 141,623,495	V68M	probably benign	Het
Slc25a48	A	T	13: 56,465,078	E263V	probably damaging	Het
Slc7a14	A	G	3: 31,257,610	V87A	probably damaging	Het
Slc8b1	A	G	5: 120,529,600	I433V	probably damaging	Het
Smurf1	A	G	5: 144,894,504	V259A	possibly damaging	Het
Spag6l	T	A	16: 16,781,788	N270I	possibly damaging	Het
Tas2r113	G	A	6: 132,893,014	V2M	probably damaging	Het
Tnpo2	T	C	8: 85,053,475	V680A	probably damaging	Het
Ttyh3	A	C	5: 140,633,562		probably null	Het
Ufl1	A	G	4: 25,251,999	S639P	possibly damaging	Het
Znfx1	A	T	2: 167,037,081	F928I	possibly damaging	Het

Other mutations in Inpp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01348:Inpp4a	APN	1	37388905	missense	probably damaging	1.00
IGL01821:Inpp4a	APN	1	37377717	missense	probably damaging	1.00
IGL02015:Inpp4a	APN	1	37389712	missense	probably damaging	1.00
IGL02036:Inpp4a	APN	1	37377569	intron	probably benign
IGL02040:Inpp4a	APN	1	37396085	missense	probably damaging	0.99
IGL02082:Inpp4a	APN	1	37366627	intron	probably benign
IGL02318:Inpp4a	APN	1	37368303	missense	probably damaging	1.00
IGL02555:Inpp4a	APN	1	37379968	missense	possibly damaging	0.70
IGL02622:Inpp4a	APN	1	37379034	missense	probably benign	0.26
stultified	UTSW	1	37387830	missense	probably damaging	0.99
R0265:Inpp4a	UTSW	1	37378986	missense	probably damaging	1.00
R0388:Inpp4a	UTSW	1	37396160	missense	probably damaging	0.96
R0543:Inpp4a	UTSW	1	37369492	intron	probably benign
R1269:Inpp4a	UTSW	1	37389742	missense	probably benign	0.01
R1719:Inpp4a	UTSW	1	37398799	missense	probably damaging	1.00
R1799:Inpp4a	UTSW	1	37392978	missense	possibly damaging	0.56
R2127:Inpp4a	UTSW	1	37366919	missense	probably benign	0.08
R2143:Inpp4a	UTSW	1	37387746	missense	probably damaging	1.00
R2174:Inpp4a	UTSW	1	37396130	missense	probably damaging	1.00
R2258:Inpp4a	UTSW	1	37377696	missense	probably damaging	1.00
R2327:Inpp4a	UTSW	1	37366166	missense	probably damaging	0.96
R2437:Inpp4a	UTSW	1	37392956	missense	probably damaging	1.00
R2897:Inpp4a	UTSW	1	37366594	missense	probably benign	0.07
R2898:Inpp4a	UTSW	1	37366594	missense	probably benign	0.07
R4830:Inpp4a	UTSW	1	37371780	missense	probably damaging	1.00
R4934:Inpp4a	UTSW	1	37387841	missense	possibly damaging	0.74
R5141:Inpp4a	UTSW	1	37380087	missense	probably benign	0.17
R5152:Inpp4a	UTSW	1	37358535	missense	possibly damaging	0.88
R5627:Inpp4a	UTSW	1	37367773	missense	probably damaging	0.96
R5789:Inpp4a	UTSW	1	37372329	missense	possibly damaging	0.75
R6004:Inpp4a	UTSW	1	37372370	missense	probably damaging	0.99
R6180:Inpp4a	UTSW	1	37380102	missense	probably benign
R6434:Inpp4a	UTSW	1	37398838	missense	probably damaging	1.00
R6571:Inpp4a	UTSW	1	37387758	missense	probably damaging	1.00
R6766:Inpp4a	UTSW	1	37372341	missense	probably damaging	1.00
R6992:Inpp4a	UTSW	1	37389691	missense	probably damaging	0.98
R7025:Inpp4a	UTSW	1	37369423	missense	probably benign	0.00
R7126:Inpp4a	UTSW	1	37374272	missense	probably benign	0.00
R7473:Inpp4a	UTSW	1	37369453	missense	probably benign	0.37
R7509:Inpp4a	UTSW	1	37387830	missense	probably damaging	0.99
R7654:Inpp4a	UTSW	1	37374098	splice site	probably null
R7920:Inpp4a	UTSW	1	37367805	missense	probably benign	0.08
R8273:Inpp4a	UTSW	1	37368439	intron	probably benign
RF006:Inpp4a	UTSW	1	37388827	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- GTACATCTTCTAGTGGCCAGTC -3'
(R):5'- TCAACCCATTGGCCTAAAGC -3'

Sequencing Primer
(F):5'- TGGCCAGTCCATCATCTACATAC -3'
(R):5'- TTGGCCTAAAGCTACAATCGG -3'

Posted On

2017-08-16