Incidental Mutation 'R6107:Olfr1286'
ID485542
Institutional Source Beutler Lab
Gene Symbol Olfr1286
Ensembl Gene ENSMUSG00000096703
Gene Nameolfactory receptor 1286
SynonymsMOR248-21, GA_x6K02T2Q125-72472405-72471488
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111417842-111423115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111420655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 99 (S99G)
Ref Sequence ENSEMBL: ENSMUSP00000148932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099617] [ENSMUST00000184954] [ENSMUST00000213210]
Predicted Effect probably benign
Transcript: ENSMUST00000099617
AA Change: S99G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097212
Gene: ENSMUSG00000096703
AA Change: S99G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.4e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.4e-7 PFAM
Pfam:7tm_1 41 287 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184954
AA Change: S99G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: S99G

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213210
AA Change: S99G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Olfr1286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Olfr1286 APN 2 111420892 missense probably benign 0.04
IGL01953:Olfr1286 APN 2 111420312 missense probably benign 0.22
IGL02251:Olfr1286 APN 2 111420312 missense probably damaging 0.99
IGL02514:Olfr1286 APN 2 111420772 missense probably damaging 1.00
IGL02868:Olfr1286 APN 2 111420493 missense possibly damaging 0.55
PIT4403001:Olfr1286 UTSW 2 111420820 missense probably benign 0.00
R0630:Olfr1286 UTSW 2 111420846 missense probably damaging 1.00
R1442:Olfr1286 UTSW 2 111420093 missense probably damaging 1.00
R1712:Olfr1286 UTSW 2 111420658 missense probably benign 0.22
R2510:Olfr1286 UTSW 2 111420451 missense possibly damaging 0.74
R4399:Olfr1286 UTSW 2 111420799 missense probably benign 0.00
R4984:Olfr1286 UTSW 2 111420847 missense probably damaging 1.00
R5186:Olfr1286 UTSW 2 111420774 missense probably damaging 1.00
R6044:Olfr1286 UTSW 2 111420078 missense probably damaging 1.00
R6372:Olfr1286 UTSW 2 111420802 missense probably benign 0.12
R7230:Olfr1286 UTSW 2 111420916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGATCCAAAATCAAGAGCATCTG -3'
(R):5'- ATCCTCTACCTGATGGCTGTG -3'

Sequencing Primer
(F):5'- GCATCTGACTAATGGCATGC -3'
(R):5'- CTCTACCTGATGGCTGTGGTAGG -3'
Posted On2017-08-16