Incidental Mutation 'R6107:Patl2'
ID 485543
Institutional Source Beutler Lab
Gene Symbol Patl2
Ensembl Gene ENSMUSG00000027233
Gene Name protein associated with topoisomerase II homolog 2 (yeast)
Synonyms Pat1a, 4930424G05Rik
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R6107 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122120108-122186189 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122127486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 97 (L97Q)
Ref Sequence ENSEMBL: ENSMUSP00000028665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665]
AlphaFold A2ARM1
Predicted Effect probably damaging
Transcript: ENSMUST00000028665
AA Change: L97Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: L97Q

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Patl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Patl2 APN 2 122123810 missense probably benign 0.19
IGL01780:Patl2 APN 2 122121846 missense probably damaging 1.00
IGL02604:Patl2 APN 2 122125333 missense possibly damaging 0.80
IGL02713:Patl2 APN 2 122125847 missense probably benign 0.01
IGL02990:Patl2 APN 2 122124497 critical splice acceptor site probably null
FR4304:Patl2 UTSW 2 122126135 small insertion probably benign
FR4548:Patl2 UTSW 2 122126135 small insertion probably benign
FR4737:Patl2 UTSW 2 122126136 small insertion probably benign
FR4737:Patl2 UTSW 2 122126144 nonsense probably null
FR4737:Patl2 UTSW 2 122126145 small insertion probably benign
FR4976:Patl2 UTSW 2 122126139 small insertion probably benign
FR4976:Patl2 UTSW 2 122126141 small insertion probably benign
FR4976:Patl2 UTSW 2 122126144 small insertion probably benign
FR4976:Patl2 UTSW 2 122126145 small insertion probably benign
R0001:Patl2 UTSW 2 122125710 splice site probably benign
R0002:Patl2 UTSW 2 122125710 splice site probably benign
R0540:Patl2 UTSW 2 122126669 missense probably benign
R0570:Patl2 UTSW 2 122125308 missense probably damaging 0.99
R0607:Patl2 UTSW 2 122126669 missense probably benign
R1463:Patl2 UTSW 2 122123735 missense probably benign 0.38
R2992:Patl2 UTSW 2 122125754 missense probably damaging 0.97
R4329:Patl2 UTSW 2 122127537 missense probably benign 0.01
R4583:Patl2 UTSW 2 122126745 missense probably benign 0.00
R4737:Patl2 UTSW 2 122125306 missense probably damaging 1.00
R4965:Patl2 UTSW 2 122128848 nonsense probably null
R5091:Patl2 UTSW 2 122123802 missense probably benign 0.01
R5256:Patl2 UTSW 2 122128887 missense probably damaging 1.00
R5450:Patl2 UTSW 2 122125281 missense probably benign 0.00
R5990:Patl2 UTSW 2 122124484 missense probably damaging 1.00
R6028:Patl2 UTSW 2 122126137 missense possibly damaging 0.76
R6597:Patl2 UTSW 2 122186164 start gained probably benign
R6969:Patl2 UTSW 2 122128929 missense possibly damaging 0.52
R7131:Patl2 UTSW 2 122121782 critical splice donor site probably null
R7436:Patl2 UTSW 2 122127525 missense probably benign 0.00
R7718:Patl2 UTSW 2 122126774 splice site probably null
R7852:Patl2 UTSW 2 122179109 unclassified probably benign
R8397:Patl2 UTSW 2 122125273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCACCCCATACCAATG -3'
(R):5'- CCATGCAGTTACTGTCCTGG -3'

Sequencing Primer
(F):5'- ATACCAATGCCTCCCTTGGGG -3'
(R):5'- CAGTTACTGTCCTGGCTGTTGAAATG -3'
Posted On 2017-08-16