Incidental Mutation 'R6107:Med23'
ID485562
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24906034 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 713 (K713*)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably null
Transcript: ENSMUST00000020159
AA Change: K1073*
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: K1073*

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092646
AA Change: K1079*
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: K1079*

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176285
AA Change: K713*
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: K713*

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184228
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTCTTCTTGACAGACCGG -3'
(R):5'- GCAATGAGGCTAAGGTTGGC -3'

Sequencing Primer
(F):5'- AGACCGGCCAGTGACTTATCTG -3'
(R):5'- TAAGGTTGGCCTAAGCAACTC -3'
Posted On2017-08-16