Mutagenetix > Incidental Mutation

Incidental Mutation 'R6107:Med23'

485562

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

044257-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6107 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 24906034 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 713 (K713*)

Ref Sequence

ENSEMBL: ENSMUSP00000135232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000020159
AA Change: K1073*

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: K1073*

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000092646
AA Change: K1079*

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: K1079*

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000176285
AA Change: K713*

SMART Domains

Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: K713*

Domain	Start	End	E-Value	Type
Pfam:Med23	1	51	4.4e-14	PFAM
Pfam:Med23	48	950	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184228

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrl3	A	G	5: 81,688,563	R723G	probably damaging	Het
Ankrd52	C	A	10: 128,387,012	N610K	probably benign	Het
Atp2a3	A	G	11: 72,988,461		probably null	Het
Bahcc1	G	A	11: 120,272,888	A671T	probably benign	Het
Col6a5	A	T	9: 105,892,272	Y1764*	probably null	Het
E2f8	A	G	7: 48,867,676	V793A	probably benign	Het
Erbin	A	G	13: 103,833,892	I1072T	probably benign	Het
Exoc2	T	C	13: 30,876,797	I575V	probably benign	Het
Fbxw19	C	T	9: 109,495,766	V28M	probably damaging	Het
Flt1	G	A	5: 147,603,593	T762M	probably benign	Het
Ghitm	C	A	14: 37,125,209	A303S	probably damaging	Het
Gm18856	T	A	13: 13,965,734		probably benign	Het
Gm5493	T	A	17: 22,748,096	H68Q	possibly damaging	Het
Hells	T	G	19: 38,953,649	I461S	probably benign	Het
Inpp4a	T	A	1: 37,377,748	I450N	probably damaging	Het
Kbtbd6	T	A	14: 79,453,113	V353D	probably damaging	Het
Kifap3	A	T	1: 163,868,769	T656S	possibly damaging	Het
Miga1	A	T	3: 152,335,399	F44I	probably benign	Het
Ngrn	A	G	7: 80,261,877	E74G	probably damaging	Het
Olfr1286	T	C	2: 111,420,655	S99G	probably benign	Het
Patl2	A	T	2: 122,127,486	L97Q	probably damaging	Het
Pcdha1	A	G	18: 36,932,301	I673V	probably benign	Het
Pcsk1	A	G	13: 75,127,848	T543A	probably benign	Het
Plch1	C	T	3: 63,702,023	R912H	probably damaging	Het
Prl8a8	A	G	13: 27,511,464	V100A	possibly damaging	Het
Rnase10	T	A	14: 51,009,294	V43E	possibly damaging	Het
Robo1	A	G	16: 72,983,829	S816G	probably benign	Het
Slc25a34	C	T	4: 141,623,495	V68M	probably benign	Het
Slc25a48	A	T	13: 56,465,078	E263V	probably damaging	Het
Slc7a14	A	G	3: 31,257,610	V87A	probably damaging	Het
Slc8b1	A	G	5: 120,529,600	I433V	probably damaging	Het
Smurf1	A	G	5: 144,894,504	V259A	possibly damaging	Het
Spag6l	T	A	16: 16,781,788	N270I	possibly damaging	Het
Tas2r113	G	A	6: 132,893,014	V2M	probably damaging	Het
Tnpo2	T	C	8: 85,053,475	V680A	probably damaging	Het
Ttyh3	A	C	5: 140,633,562		probably null	Het
Ufl1	A	G	4: 25,251,999	S639P	possibly damaging	Het
Znfx1	A	T	2: 167,037,081	F928I	possibly damaging	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
R8975:Med23	UTSW	10	24904436	missense	probably benign	0.42
R9131:Med23	UTSW	10	24904381	missense
R9202:Med23	UTSW	10	24904304	missense	probably benign	0.12
R9341:Med23	UTSW	10	24912807	missense	probably benign
R9342:Med23	UTSW	10	24874571	missense	probably benign	0.01
R9343:Med23	UTSW	10	24912807	missense	probably benign
R9412:Med23	UTSW	10	24902121	missense	probably damaging	1.00
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTTCTTCTTGACAGACCGG -3'
(R):5'- GCAATGAGGCTAAGGTTGGC -3'

Sequencing Primer
(F):5'- AGACCGGCCAGTGACTTATCTG -3'
(R):5'- TAAGGTTGGCCTAAGCAACTC -3'

Posted On

2017-08-16