Incidental Mutation 'R6107:Atp2a3'
ID485565
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene NameATPase, Ca++ transporting, ubiquitous
SynonymsSerca3
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72961169-72993044 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 72988461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
Predicted Effect probably null
Transcript: ENSMUST00000021142
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108484
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108485
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108486
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135234
Predicted Effect probably null
Transcript: ENSMUST00000163326
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72982787 missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72982665 missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72981897 missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72987984 missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72977207 missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72977128 splice site probably benign
R0193:Atp2a3 UTSW 11 72972220 missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72970931 critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72982702 missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72977232 splice site probably null
R0494:Atp2a3 UTSW 11 72981905 missense probably damaging 1.00
R0588:Atp2a3 UTSW 11 72973024 missense possibly damaging 0.79
R0674:Atp2a3 UTSW 11 72981885 missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72991744 missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72978807 critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72975414 missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72980448 missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72981797 missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72973029 missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72982680 missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72982826 missense probably null 0.49
R5174:Atp2a3 UTSW 11 72980215 missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72975397 missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72988557 missense probably damaging 0.98
R5802:Atp2a3 UTSW 11 72972882 missense probably damaging 1.00
R6157:Atp2a3 UTSW 11 72980616 missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72982740 missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72978750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGTCTAAGGCCAAAAG -3'
(R):5'- ACTGTAACCCCAGGAACTTCG -3'

Sequencing Primer
(F):5'- ATGAAGATTGAGGTCTCTGGAC -3'
(R):5'- CCCAGGAACTTCGGAGGGAG -3'
Posted On2017-08-16