Incidental Mutation 'R6107:Spag6l'
ID 485576
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Name sperm associated antigen 6-like
Synonyms PF16, Spag6
MMRRC Submission 044257-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.297) question?
Stock # R6107 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 16570880-16647227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16599652 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 270 (N270I)
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
AlphaFold Q9JLI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000023468
AA Change: N270I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: N270I

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrl3 A G 5: 81,836,410 (GRCm39) R723G probably damaging Het
Ankrd52 C A 10: 128,222,881 (GRCm39) N610K probably benign Het
Atp2a3 A G 11: 72,879,287 (GRCm39) probably null Het
Bahcc1 G A 11: 120,163,714 (GRCm39) A671T probably benign Het
Col6a5 A T 9: 105,769,471 (GRCm39) Y1764* probably null Het
E2f8 A G 7: 48,517,424 (GRCm39) V793A probably benign Het
Erbin A G 13: 103,970,400 (GRCm39) I1072T probably benign Het
Exoc2 T C 13: 31,060,780 (GRCm39) I575V probably benign Het
Fbxw19 C T 9: 109,324,834 (GRCm39) V28M probably damaging Het
Flt1 G A 5: 147,540,403 (GRCm39) T762M probably benign Het
Ghitm C A 14: 36,847,166 (GRCm39) A303S probably damaging Het
Gm18856 T A 13: 14,140,319 (GRCm39) probably benign Het
Gm5493 T A 17: 22,967,069 (GRCm39) H68Q possibly damaging Het
Hells T G 19: 38,942,093 (GRCm39) I461S probably benign Het
Inpp4a T A 1: 37,416,829 (GRCm39) I450N probably damaging Het
Kbtbd6 T A 14: 79,690,553 (GRCm39) V353D probably damaging Het
Kifap3 A T 1: 163,696,338 (GRCm39) T656S possibly damaging Het
Med23 A T 10: 24,781,932 (GRCm39) K713* probably null Het
Miga1 A T 3: 152,041,036 (GRCm39) F44I probably benign Het
Ngrn A G 7: 79,911,625 (GRCm39) E74G probably damaging Het
Or4k40 T C 2: 111,251,000 (GRCm39) S99G probably benign Het
Patl2 A T 2: 121,957,967 (GRCm39) L97Q probably damaging Het
Pcdha1 A G 18: 37,065,354 (GRCm39) I673V probably benign Het
Pcsk1 A G 13: 75,275,967 (GRCm39) T543A probably benign Het
Plch1 C T 3: 63,609,444 (GRCm39) R912H probably damaging Het
Prl8a8 A G 13: 27,695,447 (GRCm39) V100A possibly damaging Het
Rnase10 T A 14: 51,246,751 (GRCm39) V43E possibly damaging Het
Robo1 A G 16: 72,780,717 (GRCm39) S816G probably benign Het
Slc25a34 C T 4: 141,350,806 (GRCm39) V68M probably benign Het
Slc25a48 A T 13: 56,612,891 (GRCm39) E263V probably damaging Het
Slc7a14 A G 3: 31,311,759 (GRCm39) V87A probably damaging Het
Slc8b1 A G 5: 120,667,665 (GRCm39) I433V probably damaging Het
Smurf1 A G 5: 144,831,314 (GRCm39) V259A possibly damaging Het
Tas2r113 G A 6: 132,869,977 (GRCm39) V2M probably damaging Het
Tnpo2 T C 8: 85,780,104 (GRCm39) V680A probably damaging Het
Ttyh3 A C 5: 140,619,317 (GRCm39) probably null Het
Ufl1 A G 4: 25,251,999 (GRCm39) S639P possibly damaging Het
Znfx1 A T 2: 166,879,001 (GRCm39) F928I possibly damaging Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16,598,597 (GRCm39) missense probably benign 0.20
IGL00928:Spag6l APN 16 16,584,877 (GRCm39) missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16,584,877 (GRCm39) missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16,599,721 (GRCm39) missense probably damaging 1.00
IGL02380:Spag6l APN 16 16,581,033 (GRCm39) critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16,598,592 (GRCm39) missense probably damaging 1.00
R0284:Spag6l UTSW 16 16,598,630 (GRCm39) missense probably damaging 0.99
R0394:Spag6l UTSW 16 16,598,493 (GRCm39) missense probably benign
R0720:Spag6l UTSW 16 16,584,960 (GRCm39) splice site probably benign
R1205:Spag6l UTSW 16 16,605,171 (GRCm39) missense probably damaging 1.00
R1496:Spag6l UTSW 16 16,598,478 (GRCm39) splice site probably benign
R1707:Spag6l UTSW 16 16,598,492 (GRCm39) missense probably benign 0.00
R1926:Spag6l UTSW 16 16,580,921 (GRCm39) missense probably benign 0.00
R2255:Spag6l UTSW 16 16,595,203 (GRCm39) missense probably damaging 0.96
R2330:Spag6l UTSW 16 16,646,949 (GRCm39) missense probably benign
R3755:Spag6l UTSW 16 16,580,884 (GRCm39) critical splice donor site probably null
R3796:Spag6l UTSW 16 16,580,916 (GRCm39) missense probably damaging 1.00
R4093:Spag6l UTSW 16 16,646,888 (GRCm39) missense probably benign 0.05
R4324:Spag6l UTSW 16 16,605,099 (GRCm39) missense probably benign 0.00
R4725:Spag6l UTSW 16 16,610,395 (GRCm39) missense probably damaging 1.00
R4766:Spag6l UTSW 16 16,595,254 (GRCm39) missense probably benign 0.03
R4877:Spag6l UTSW 16 16,599,622 (GRCm39) missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16,584,831 (GRCm39) critical splice donor site probably null
R5958:Spag6l UTSW 16 16,580,885 (GRCm39) critical splice donor site probably null
R6894:Spag6l UTSW 16 16,601,802 (GRCm39) missense probably damaging 1.00
R7329:Spag6l UTSW 16 16,584,883 (GRCm39) missense probably benign
R7634:Spag6l UTSW 16 16,595,278 (GRCm39) missense probably damaging 0.97
R8240:Spag6l UTSW 16 16,580,889 (GRCm39) missense probably damaging 1.00
R8464:Spag6l UTSW 16 16,580,898 (GRCm39) missense probably damaging 0.97
R9207:Spag6l UTSW 16 16,598,492 (GRCm39) missense probably benign 0.00
R9682:Spag6l UTSW 16 16,646,981 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTTGACCTTGGGCCAG -3'
(R):5'- ACATCTGAATTATGAGGTTGGCTG -3'

Sequencing Primer
(F):5'- CTGAAGAGAACTTTGTGCCCTACAG -3'
(R):5'- ACTTGGCAGAGATGGTTG -3'
Posted On 2017-08-16