Incidental Mutation 'R6107:Gm5493'
ID485578
Institutional Source Beutler Lab
Gene Symbol Gm5493
Ensembl Gene ENSMUSG00000098164
Gene Namepredicted gene 5493
Synonyms
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22739944-22751509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22748096 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 68 (H68Q)
Ref Sequence ENSEMBL: ENSMUSP00000138596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000182063
AA Change: H68Q

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138596
Gene: ENSMUSG00000098164
AA Change: H68Q

DomainStartEndE-ValueType
KRAB 13 73 9.86e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Gm5493
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4245:Gm5493 UTSW 17 22747226 missense probably benign 0.39
R4676:Gm5493 UTSW 17 22748081 missense probably benign 0.23
R5093:Gm5493 UTSW 17 22747228 missense possibly damaging 0.68
R5638:Gm5493 UTSW 17 22750092 missense probably benign 0.06
R6020:Gm5493 UTSW 17 22748061 missense probably benign 0.19
R6275:Gm5493 UTSW 17 22750070 missense probably benign 0.03
R6965:Gm5493 UTSW 17 22748074 missense possibly damaging 0.71
R7581:Gm5493 UTSW 17 22747274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTTCTGAGCATCCATTTAATGT -3'
(R):5'- CATGGTAGAAGAACAGAAATGATATCT -3'

Sequencing Primer
(F):5'- CTGAGCATCCATTTAATGTTTGTG -3'
(R):5'- GGGAGGATTCATGTAATCATG -3'
Posted On2017-08-16