Incidental Mutation 'R0521:Myo9a'
ID48558
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 038714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0521 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59894352 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1944 (F1944L)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably damaging
Transcript: ENSMUST00000128341
AA Change: F1873L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: F1873L

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135298
AA Change: F1944L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: F1944L

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136740
AA Change: F1944L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: F1944L

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Aadacl3 A T 4: 144,455,894 S335T probably damaging Het
Abcb1b G A 5: 8,864,238 A1203T probably damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Angel1 G A 12: 86,722,907 S193F probably benign Het
Ankrd16 T C 2: 11,789,881 V359A probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Armc4 G A 18: 7,222,676 P531L possibly damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Bpifa5 C A 2: 154,166,949 D223E probably benign Het
C87499 A T 4: 88,629,322 N37K probably damaging Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Ccm2 G A 11: 6,590,886 S184N probably damaging Het
Ces5a T A 8: 93,525,658 D202V probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Cog7 C A 7: 121,941,169 probably null Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Cps1 A C 1: 67,215,564 D1304A probably benign Het
Crhbp C A 13: 95,443,895 probably null Het
Ctdspl2 T A 2: 122,006,887 C377* probably null Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Ddost A G 4: 138,310,735 T262A probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx54 A G 5: 120,626,862 I769V probably benign Het
Dock1 T A 7: 135,143,778 I1463N probably benign Het
Dsg3 T A 18: 20,527,815 Y404N possibly damaging Het
Epb42 T A 2: 121,029,150 K186* probably null Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Farp2 A G 1: 93,576,821 probably null Het
Fev C A 1: 74,882,533 R86L possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Foxn3 A G 12: 99,209,506 V261A probably benign Het
Fsd1 A G 17: 55,991,245 D190G probably benign Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Gsdma2 A T 11: 98,654,901 K260* probably null Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hic1 G A 11: 75,166,887 P392L possibly damaging Het
Hk3 C T 13: 55,014,426 probably null Het
Ifna6 G T 4: 88,827,650 V79F probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kdm5b T A 1: 134,618,033 S977R possibly damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Lrrc29 A T 8: 105,312,793 L617Q probably damaging Het
Map1a T G 2: 121,305,753 L2350R probably damaging Het
Mdfic A G 6: 15,799,756 D212G probably benign Het
Ms4a1 C A 19: 11,258,679 probably null Het
Nbea A T 3: 56,008,268 W928R probably damaging Het
Nfatc2ip T G 7: 126,396,579 D46A possibly damaging Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nsd2 T A 5: 33,843,338 N66K probably damaging Het
Nsmce4a T C 7: 130,537,002 H304R probably damaging Het
Olfr1099 C T 2: 86,958,846 G204D probably damaging Het
Olfr1239 T C 2: 89,418,200 Y71C probably damaging Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr859 G A 9: 19,808,860 V181I probably benign Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
R3hdm1 G A 1: 128,193,703 V315I probably benign Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Thnsl2 A T 6: 71,134,259 D208E probably damaging Het
Tie1 A C 4: 118,476,146 I841R probably damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tnfaip8l1 A T 17: 56,171,727 T6S probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Vmn2r9 C A 5: 108,848,288 G165* probably null Het
Xkr6 A T 14: 63,819,422 I261F probably benign Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Yipf1 A G 4: 107,336,190 Y91C probably benign Het
Zfp442 T C 2: 150,411,249 D31G possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zfp804a C T 2: 82,259,417 Q1197* probably null Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
R7473:Myo9a UTSW 9 59895244 missense probably benign 0.31
R7723:Myo9a UTSW 9 59779858 missense probably damaging 1.00
R7823:Myo9a UTSW 9 59811950 missense probably damaging 1.00
R7824:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R8031:Myo9a UTSW 9 59780091 missense probably benign 0.33
R8055:Myo9a UTSW 9 59907460 missense probably damaging 1.00
RF018:Myo9a UTSW 9 59869586 missense probably benign 0.00
RF019:Myo9a UTSW 9 59921772 missense probably benign 0.00
Z1176:Myo9a UTSW 9 59895259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCTTTGAGTCCAGAACTGCC -3'
(R):5'- GTTGACAGATCAGCTACAGCCTCAC -3'

Sequencing Primer
(F):5'- CAGAACTGCCTGGGAGTTG -3'
(R):5'- ACAGCCTCACCTTCATATTGGAC -3'
Posted On2013-06-12