Incidental Mutation 'R6108:Caprin1'
ID485589
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R6108 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103776017 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000106777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028607
AA Change: V293I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: V293I

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111147
AA Change: V293I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: V293I

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141750
Predicted Effect unknown
Transcript: ENSMUST00000143188
AA Change: V105I
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184
AA Change: V105I

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143349
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149175
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Axin1 T A 17: 26,143,240 M186K probably damaging Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Kcnn1 A C 8: 70,855,156 S81A probably benign Het
Lmod1 G A 1: 135,364,111 G235R probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slc6a20b T G 9: 123,596,186 M539L probably benign Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tas2r144 C A 6: 42,215,757 L144I possibly damaging Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 splice site probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R2945:Caprin1 UTSW 2 103772809 missense probably benign 0.04
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7624:Caprin1 UTSW 2 103772677 missense possibly damaging 0.81
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R7946:Caprin1 UTSW 2 103772748 missense probably damaging 0.99
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8324:Caprin1 UTSW 2 103783181 nonsense probably null
R8547:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8549:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8782:Caprin1 UTSW 2 103772788 missense probably benign 0.06
R8946:Caprin1 UTSW 2 103778033 missense probably damaging 1.00
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGAGTGAGTTTACAACC -3'
(R):5'- AGCATTCCTGTTAGAGGTGC -3'

Sequencing Primer
(F):5'- ATTTTCATGACTGCTTCCCAAAC -3'
(R):5'- GTGCATTTGTTACAGTTGATAAGCC -3'
Posted On2017-08-16