Mutagenetix > Incidental Mutation

Incidental Mutation 'R0521:Il20ra'

48560

Institutional Source

Beutler Lab

Gene Symbol

Il20ra

Ensembl Gene

ENSMUSG00000020007

Gene Name

interleukin 20 receptor, alpha

Synonyms

MMRRC Submission

038714-MU

Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0521 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19712570-19760053 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19759640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 543 (Q543L)

Ref Sequence

ENSEMBL: ENSMUSP00000020185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]

AlphaFold

Q6PHB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000020185
AA Change: Q543L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: Q543L

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	16	126	1.8e-33	PFAM
Pfam:Interfer-bind	138	243	4.6e-23	PFAM
transmembrane domain	255	277	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217389

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2900011O08Rik	T	A	16: 13,986,812	S8T	possibly damaging	Het
Aadacl3	A	T	4: 144,455,894	S335T	probably damaging	Het
Abcb1b	G	A	5: 8,864,238	A1203T	probably damaging	Het
Agt	C	A	8: 124,557,100	E427*	probably null	Het
Angel1	G	A	12: 86,722,907	S193F	probably benign	Het
Ankrd16	T	C	2: 11,789,881	V359A	probably benign	Het
Ankrd33b	T	C	15: 31,367,286	D36G	probably damaging	Het
Ano8	A	T	8: 71,479,258	C766S	probably benign	Het
Armc4	G	A	18: 7,222,676	P531L	possibly damaging	Het
Asic1	C	T	15: 99,698,819	R499C	probably damaging	Het
Bank1	C	T	3: 136,213,942	C364Y	probably damaging	Het
Bpifa5	C	A	2: 154,166,949	D223E	probably benign	Het
C87499	A	T	4: 88,629,322	N37K	probably damaging	Het
Capn5	C	T	7: 98,132,882	R217Q	probably damaging	Het
Ccm2	G	A	11: 6,590,886	S184N	probably damaging	Het
Ces5a	T	A	8: 93,525,658	D202V	probably damaging	Het
Clasrp	A	G	7: 19,588,603	I284T	probably benign	Het
Cog7	C	A	7: 121,941,169		probably null	Het
Col13a1	A	T	10: 61,862,746	M512K	unknown	Het
Cps1	A	C	1: 67,215,564	D1304A	probably benign	Het
Crhbp	C	A	13: 95,443,895		probably null	Het
Ctdspl2	T	A	2: 122,006,887	C377*	probably null	Het
Ctsl	G	A	13: 64,365,218	L297F	possibly damaging	Het
Ddost	A	G	4: 138,310,735	T262A	probably benign	Het
Ddx4	A	T	13: 112,624,779		probably null	Het
Ddx54	A	G	5: 120,626,862	I769V	probably benign	Het
Dock1	T	A	7: 135,143,778	I1463N	probably benign	Het
Dsg3	T	A	18: 20,527,815	Y404N	possibly damaging	Het
Epb42	T	A	2: 121,029,150	K186*	probably null	Het
Fam173b	T	G	15: 31,605,957	S20R	probably benign	Het
Farp2	A	G	1: 93,576,821		probably null	Het
Fev	C	A	1: 74,882,533	R86L	possibly damaging	Het
Foxb2	G	T	19: 16,872,456	C395*	probably null	Het
Foxn3	A	G	12: 99,209,506	V261A	probably benign	Het
Fsd1	A	G	17: 55,991,245	D190G	probably benign	Het
Gm9930	A	T	10: 9,534,803		noncoding transcript	Het
Gsdma2	A	T	11: 98,654,901	K260*	probably null	Het
Hdac7	G	A	15: 97,806,499	Q497*	probably null	Het
Hic1	G	A	11: 75,166,887	P392L	possibly damaging	Het
Hk3	C	T	13: 55,014,426		probably null	Het
Ifna6	G	T	4: 88,827,650	V79F	probably benign	Het
Itk	T	A	11: 46,360,288	D163V	probably damaging	Het
Kcnu1	T	G	8: 25,910,888	L688R	probably damaging	Het
Kdm5b	T	A	1: 134,618,033	S977R	possibly damaging	Het
Kng1	G	A	16: 23,060,482	A45T	possibly damaging	Het
Lrrc29	A	T	8: 105,312,793	L617Q	probably damaging	Het
Map1a	T	G	2: 121,305,753	L2350R	probably damaging	Het
Mdfic	A	G	6: 15,799,756	D212G	probably benign	Het
Ms4a1	C	A	19: 11,258,679		probably null	Het
Myo9a	T	A	9: 59,894,352	F1944L	probably damaging	Het
Nbea	A	T	3: 56,008,268	W928R	probably damaging	Het
Nfatc2ip	T	G	7: 126,396,579	D46A	possibly damaging	Het
Ngly1	C	T	14: 16,290,774	Q419*	probably null	Het
Nsd2	T	A	5: 33,843,338	N66K	probably damaging	Het
Nsmce4a	T	C	7: 130,537,002	H304R	probably damaging	Het
Olfr1099	C	T	2: 86,958,846	G204D	probably damaging	Het
Olfr1239	T	C	2: 89,418,200	Y71C	probably damaging	Het
Olfr1381	C	T	11: 49,552,464	T239M	probably damaging	Het
Olfr624	T	A	7: 103,670,489	I181F	possibly damaging	Het
Olfr714	T	A	7: 107,074,758	L310Q	possibly damaging	Het
Olfr859	G	A	9: 19,808,860	V181I	probably benign	Het
Olfr898	A	C	9: 38,349,203	N40T	probably damaging	Het
Peg3	T	C	7: 6,711,428	E265G	probably damaging	Het
Pkd1	A	G	17: 24,595,219	S4188G	probably benign	Het
R3hdm1	G	A	1: 128,193,703	V315I	probably benign	Het
Rab24	A	T	13: 55,320,925		probably null	Het
Rap1gap2	A	T	11: 74,441,766	M71K	probably damaging	Het
Rergl	T	G	6: 139,496,526	K42T	probably damaging	Het
Sept5	T	C	16: 18,624,897	T92A	probably benign	Het
Setdb1	A	G	3: 95,338,829	V595A	probably benign	Het
Slc17a8	A	G	10: 89,576,330	S414P	probably benign	Het
Thnsl2	A	T	6: 71,134,259	D208E	probably damaging	Het
Tie1	A	C	4: 118,476,146	I841R	probably damaging	Het
Tll1	T	G	8: 64,098,471	D292A	probably damaging	Het
Tnfaip8l1	A	T	17: 56,171,727	T6S	probably damaging	Het
Trim17	T	A	11: 58,968,494	V178E	probably damaging	Het
Ttc27	A	T	17: 74,856,549	R717S	possibly damaging	Het
Upk2	G	T	9: 44,454,121	P50Q	probably damaging	Het
Usp9y	A	T	Y: 1,307,880	C2319S	probably benign	Het
Vmn2r100	A	T	17: 19,521,916	D184V	probably damaging	Het
Vmn2r9	C	A	5: 108,848,288	G165*	probably null	Het
Xkr6	A	T	14: 63,819,422	I261F	probably benign	Het
Xpnpep3	T	G	15: 81,427,492	I133S	possibly damaging	Het
Yipf1	A	G	4: 107,336,190	Y91C	probably benign	Het
Zfp442	T	C	2: 150,411,249	D31G	possibly damaging	Het
Zfp628	A	T	7: 4,919,940	Q387L	probably damaging	Het
Zfp804a	C	T	2: 82,259,417	Q1197*	probably null	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Il20ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01929:Il20ra	APN	10	19759271	missense	probably benign	0.01
IGL01936:Il20ra	APN	10	19755843	missense	probably damaging	1.00
IGL01958:Il20ra	APN	10	19759043	missense	probably benign	0.39
IGL02109:Il20ra	APN	10	19759505	missense	possibly damaging	0.80
IGL02207:Il20ra	APN	10	19751578	missense	probably damaging	0.99
IGL02234:Il20ra	APN	10	19749270	missense	probably damaging	1.00
IGL02959:Il20ra	APN	10	19759041	missense	probably benign	0.10
IGL03010:Il20ra	APN	10	19749212	missense	probably damaging	1.00
P0017:Il20ra	UTSW	10	19759406	missense	probably damaging	1.00
R0518:Il20ra	UTSW	10	19759640	missense	probably damaging	1.00
R1436:Il20ra	UTSW	10	19749252	missense	probably damaging	1.00
R1714:Il20ra	UTSW	10	19755828	missense	probably damaging	0.98
R1792:Il20ra	UTSW	10	19759636	missense	probably damaging	0.99
R1852:Il20ra	UTSW	10	19743019	missense	probably damaging	1.00
R2097:Il20ra	UTSW	10	19759463	missense	probably damaging	1.00
R4559:Il20ra	UTSW	10	19749284	missense	probably damaging	0.99
R4970:Il20ra	UTSW	10	19758943	missense	possibly damaging	0.61
R5112:Il20ra	UTSW	10	19758943	missense	possibly damaging	0.61
R5267:Il20ra	UTSW	10	19749359	missense	probably damaging	0.99
R6543:Il20ra	UTSW	10	19749323	missense	probably damaging	1.00
R6755:Il20ra	UTSW	10	19750794	missense	probably benign	0.15
R6845:Il20ra	UTSW	10	19759311	missense	probably benign	0.06
R7014:Il20ra	UTSW	10	19712710	missense	unknown
R7190:Il20ra	UTSW	10	19742941	missense	probably damaging	0.99
R8134:Il20ra	UTSW	10	19750704	missense	probably damaging	0.99
R8955:Il20ra	UTSW	10	19759412	missense	possibly damaging	0.57
R9104:Il20ra	UTSW	10	19759616	missense	probably benign	0.21
R9439:Il20ra	UTSW	10	19743003	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGACCCACAGCTTGAAGACCTAC -3'
(R):5'- TGGATGGAAGCCAATCACATGGATG -3'

Sequencing Primer
(F):5'- CAAACTGGCAGGCTGTGTATC -3'
(R):5'- CCAATCACATGGATGAGGCAG -3'

Posted On

2013-06-12