Incidental Mutation 'R6108:Tas2r144'
ID485604
Institutional Source Beutler Lab
Gene Symbol Tas2r144
Ensembl Gene ENSMUSG00000051917
Gene Nametaste receptor, type 2, member 144
Synonymsmt2r33, Tas2r44
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6108 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42215328-42216287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42215757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 144 (L144I)
Ref Sequence ENSEMBL: ENSMUSP00000067734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063489
AA Change: L144I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067734
Gene: ENSMUSG00000051917
AA Change: L144I

DomainStartEndE-ValueType
Pfam:TAS2R 12 314 9.6e-63 PFAM
Meta Mutation Damage Score 0.4237 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Axin1 T A 17: 26,143,240 M186K probably damaging Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Caprin1 C T 2: 103,776,017 V293I possibly damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Kcnn1 A C 8: 70,855,156 S81A probably benign Het
Lmod1 G A 1: 135,364,111 G235R probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slc6a20b T G 9: 123,596,186 M539L probably benign Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Tas2r144
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Tas2r144 APN 6 42216076 missense probably benign 0.26
IGL02644:Tas2r144 APN 6 42215853 missense possibly damaging 0.89
IGL02816:Tas2r144 APN 6 42215605 missense probably benign 0.03
R0375:Tas2r144 UTSW 6 42216124 missense possibly damaging 0.92
R1526:Tas2r144 UTSW 6 42215740 missense probably benign
R1543:Tas2r144 UTSW 6 42215603 missense probably benign 0.00
R1678:Tas2r144 UTSW 6 42215556 missense probably benign 0.44
R1868:Tas2r144 UTSW 6 42216002 missense probably benign 0.01
R1880:Tas2r144 UTSW 6 42216070 missense probably benign 0.02
R4060:Tas2r144 UTSW 6 42215629 missense possibly damaging 0.82
R5173:Tas2r144 UTSW 6 42216114 missense probably benign 0.40
R6249:Tas2r144 UTSW 6 42215357 nonsense probably null
R6533:Tas2r144 UTSW 6 42215346 missense probably benign
R6850:Tas2r144 UTSW 6 42215923 missense possibly damaging 0.71
R7237:Tas2r144 UTSW 6 42215866 missense probably damaging 0.99
R7296:Tas2r144 UTSW 6 42215439 missense probably damaging 1.00
R7431:Tas2r144 UTSW 6 42215974 missense probably damaging 1.00
X0067:Tas2r144 UTSW 6 42216165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGAGAACCTTATGTTGATGC -3'
(R):5'- GAGTGGCTGCCATGATGAAC -3'

Sequencing Primer
(F):5'- TCCCGATCATTTATAACCATAATGCC -3'
(R):5'- AGGAAGGAAGATCCCCATATAATAC -3'
Posted On2017-08-16